Description :
From Genome Similarity Track
Location :
Scaffold_127:7760- 10157
Sequence
2397 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGCGCATTTAGGATCATGTTACCACATCGTTGATTCTAACACCCCCGGAGCCCCTGGTCAAATGGTCTGTCTTTAAC
CAAATAAATCTTTCCCCTGACTTCTCGGATGCCGATCTCCATTAGATAATGTTCCTATACATAAATCCAGGTATAACTTTTTGCTTATGTTGGACCTCCG
GCATATCTTAACATGCCCAAAAAAAGATACACCCGTTATGTTGAGAGGTCCAGCATGCGGGAACTAAGGGGTTAAATAATGCAGTGCACGCCTCGACAGG
CTACACTTCGTTCTATGTGAACGGCTTAGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGG
CTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCCTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAA
GCCAAGACATGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTAAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAAACCTACC
TACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTGATACCTCGGTTCATAGGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAAC
CTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATACCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGG
TGGCTGGGCCACGGACAGCTGCAGGGCAGCAGGTGGGAGAGCCACGGGAGGCTGAACGACAGCAAGTGGTGGATTCACAGATGGCTGATCAACAGCATGT
GGTAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCAAGGCAAGCTGAACGTTCAGCCGAGCGACTGGACGCTCAAGGTCCGAGACCTGGT
TGTGAGTCAACAGTGGTGGCTCTAACCTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAACGTGAACGTTCGCGTCGTGGACGCC
GGCGTCGTATGGACGCAGATGCCGTTTCGGCAAGTGCTGACTCTTTCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCAATGAGCATGG
TGAGCTCCACTTTCACGTGGAACGCCTTGTGGCGTGGCGTAGACACCAGGGTCGTACCCAGTACTTGGTGAAGTGGAGGGGTTATCCTCACTCACAGAAC
TCATGGGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCGTTGACGCTTACGACCGGGCACATCATGTGCCGAAGCGCCACCATGGCGTGCGAC
AGCGTCGCCAGGCGCTGGGCGCCTCCCACTAGCGTGGGGAGCGACCAGGTCAGTAGTTGAGCTCAGGCTCTGACCAGTGGCTGCAGCAGCCAGCTCGTAC
GTATAAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACCTCGTAGTGTTAGGGACATGGTCCTGAAGGAAGCAGGTGCTTCGTGTTGTGCTGAA