Description :
From Genome Similarity Track
Location :
Scaffold_588:776- 5424
Sequence
4648 bases(100 bases per row)
TGTACTTTTGTGTCCCATTTGTTTATGGACTTAAAAATTATGCGAGGTGCATGAATTATTTTAACAGGCTTAGAATCAGCGCTTGTGTTAGTCTGGTTAG
TTTGGCAATTCATCATCACAGGCAAGCAATTTTGAGGTAATGGCAGCGAGCGCTCGCCAGCGAAAACGAGGGTAACAACAATTTTCTGCTGCCGAAGGAG
GCGCTCCACGTGAAAAATGAGACAACCATTTTTCACGTGGAGCGCTACCTTCGTTGTAACCGATCGCTTCTGTGCTTGATTCTGAAGAGTTGTCTTTCTC
GAAAAAAATGACTAATAGGAGCTTTGAGCGAATAAATATGAGTGTTTTTTCTATTAGCTAACATTATTCAAAATTTTACCATTTCTTGTTACATTCTGCC
AAATTATGATGAAAACTCTATTTCTATTTACATCAATCTTACAGCTTTTATTATTAAAACCTGTAATTAAGATTTTCACGCTGCTTTCTGGATATCTGAA
ACTTCTTGTTCGAGTGAAATCCAAGACCTTTTGTATTCACTGCGTCAAAAAACTAAAACCTCAAAAACAATCAGACAAATACCGAGTATTTCTTTGGTAT
CTGCAGTTTAATTGGCACTAAAAATTTCATTACAATTTTGCAGAATGAACTCTTTCTGCTGGTCGTATTTTTGTCTAACAATACAGGCTGTGTCAAAAGT
GCGAGCCAAATGCGTGATAATCCAGAAAATATGGGACAGAGTATTATGTGATCAACGCCTGGTACACCTCACACCTTGTACTAAGTGCGATGAAGCCTAT
CCCCTTGTTTTTATGCGTCTGTAAAAAGACGCTAGTATACCTTTTACATCTTACTTAGTGTGATGTACCTTGTCCCCTATTTGTATTCGTCTGATACTAA
AAGCTCAGTGTACCTAAATGTTGTACCAAGTGCGATGTAGCATTGATCACCTCTCGATTGGTAATACGCATTTTTTTGAACCAGAACGGTGAAGCTATGA
ATGACTGAGCGTAAGTTAAGTATATATAGAGATCTTGATTCATTTCTGTCGGTAGAAGATGCTCTCGCCGACTCCACGGGACTCGGCGAGCAAGCAAATG
GTACTTAAGAGAAGGTTTAGAAAGTTGACTACTGCATCGACTGACATCTCAGGGGTTTCATAACGCCTTCAATTGTGAAGATCGCGATGCGGTTGTTACG
TCCCAGAGGTTACAAGACGCATGGGTTGCACAAAGTATATGTACGACTAGAGTGAAGATAAGAGAGTACTACGTGCACAATCTATTTACTTCTACTTTTT
CCACCGACACCTTTAACGGCTTAGCTCTATGTGCATTACAAATAGGTTATGAGCTTAACGCCCTGGACCAAGCTGCTCAGGATCAAGTCCAAGCGCCGGT
TACGAACTACGGAGCCAGTATAGCCACTGGCGCGGGCGAAGTCATGGACAGGCTGCTCGAAATGATTTAAATTTGAACGGTGACATGGGAGTTTCCGTTA
ATGTTGAGGCCCGCCGAGACGAGGGAGATCATGAAACGAAGTGAGATCCCCGCTACCGTATCACACTCTAAAGAGCGTGAAGAAACGCTCTTATTTATAA
GGTATATATAACTCTGTTTTTATTTTTTATTTTTATAATTCGCAATAAGTGCGAATATGTTCTCTAGCTCATGGGAACCCCTCAACTATAAATCTATTTA
TTATTGGCTAGTTATTGGGTCTGGCACCCCAATAACAAACCAATAATAAATAGACGCGCAGTATCCGCTATCCGGCTACTGCCTATACTTAATATATGCA
ATTATGTAATAAAACCTGGGACCACTTGATATAATGGGTTGCCCCATTACATCACCCCCCCTTTAAGCTGCGCTTACCGTGACGTAAGTGCCATACACAG
AAACTTTCTTCGAAACAAACAATCCAACGAAAAGCCCAACGAGAACTCCACCGGCATGTCATCTTGGTCTTCGAATCTACTCAGTTACTCACAACTGAGC
AGCATGAATCATGGACACCCACGCGAAGCGATCCCAAGCAACAGTTGGGATCATCGGACGATACGAAGAGAGCAGGTATCCCAGATCATAGATGAAGACT
TGAAGCCGTGGGGCTTGTACAGCCTCGACGGTGCTGAACAACCTGAATCACTTGAGTCGATGAAGAACCTCATTACACGATACCGTACCGCGCGAGTCAA
AGGAACGGATCACACATACACTGAAGACGCACTGAAACGATCTTGTTGCGCCTTCATTAGACGCTGGAACACGAGTCGACGTGAAGTAACATCCTTCACA
ACATGGATTGAGCGGCGCGAAGACACTCATGGTGTACACGCTATTGGCGATTTACGCCGAATTATATGTCGTCTGACTCGTGACGAGTTCCACATGTGTT
GCATCCATATCTGTGAGGAGTGCACCACGTGCTACAGGGAGAGACCGACCCCAATTTAGCAGAATGAGAAAACGTGGTATGTGCACGGGAAATGCTCCAG
CACATCCGACCATGGATCGGCCGCTATGAGAGTAGCCTCTCAAAGCTTAAAGTATCTGCGCTGCGCCACATGAGAGAGCGCCCTAGCGATCAGTGGAAGT
GTTCACGCAGCCATGATCTATTGACGTACGACCACCGTGGTCGTTCGCGTAGTCGCTCCCGATCGTCAAGATATCTAAGTGCTCTCGATCCTCGTAGTAG
ACCTCGGAGTTGCTTGGGAGATCGTCTCGATCACCAGCTCGCGAGCTTCACGGTTCGCGAGATCGTGGGATGAGTCGACAGCGTCGGTCGCGTTCACCGA
CCACTTATTGGTCTCATACTTCCCGACGACGTCAGGAAAATCGTGAGCCAACATACTTCAATTCTCCCACGTGTCGTCCGTTGGTGAATAACCGAACCAG
CAGACCTTATAATGCGTCTCGGTTCGACTCTTTGATGGCGCCAAGTCACGACTCGGTACAAAACGCGGGGGTATTCATGACCGACGATAAGGTCCACGAT
CCAACGTCGTTCACCCGATGCATCCACCAAGGGAGGTGAAGCATCACGACGGAAGGTCTCTAGGGTTGGGCGCCGATTCGCATAATCGGGCACCTGTGCT
GTCAAACGAAGAGCTGCGTTTTCTTCGTGCCGACACTATAGAGGCGATGAACGGCCTACTGGATGCCCGTGATATGGCCGAGAGTGCTCGCGATCGTGCA
GCAGCTGCTACGGAGGCTCCCGAGAGGACTCGACGGGAGCGGCAGGGTTTAATGGAGCGTCTACGCCAGCTTGAGACTTCTGCGTTCGGTGGGCCCCAGC
AGAACGAGTCTGCACGGGATCGTACAGGAATTGGTCCCAGTCGTCGTCAGCGTCGTCGACAGTAGATGTCGGAATTCGAGCCGACGCAGAAAAGAGGGAA
AGGTTCGAAGGAAGATCCGCGATCAGGTATGCCTTAAATCGCCTGACATAGAGCGTCGGGTGCAAACGCATAGTGGTAGGTATGTCTAGCGTGTAAGCGT
CTCCATGTGTCTTAACAACCCGAAAGGGATCAATATATCTTGGCGGTAAAATATTAGCGCCTAAGTTCGTCCCAGATGTGTCTGGTAATCAGTTTGTTGA
TAACAAGACTCTGTCACCTTCTTTAAACATCAACTTGTTCTTTTGACGTCTCTTGTCAGCGTTCTCGTTTTGTGTATCCACTGATTTTTGAAGGGGGTCA
CGTACAAAACGCGTGATGCCTTGTTGATTTAATATGAATTCGGTCACAAAAGCCAAACTTACAGGTGAAATGGTATTTTAGGAGCAAAAGTAGCGACGAG
AGACGCCATAGGATGCATCGCGTCCGGACTAGACATGTCATTCGCCACGAAATTAACAGCATAAGTTGCATCGGCAGCAACCTTATCTTCAACATAATCA
ATCATCAAATGTTTTGGCGTAATGCCATAGGCAGATACCCCCCCCCCCACACCAAGCTTAAGAACCGGGTTTTCTGAAGCTGAAAGATCAAGAAGCGCTG
GAACGCGAGGGTGCCTCGCTTTGTTCAAGAAAAATGGCGTCGATCCTGTTAACGCATGAACTGCATTGTTGATTGCAAATTCAGCGAGTTGGATAAATGA
ACTCCACGACGTAAATGGTGACGCATAACTGTGGAGGACATCTTTAAGCATTCAGTTCACGCGCTCCGTTGGCCCATCCATCTCTGGATGGGCTACCGTA
GACATAAGCAATCGCGATTGCGTGCCCATAGGTGAAACAACTCAGCCCAAAAAGCCGATGTGACCCGCGTTTCACGTCGAATCTAGCCCGAAATGGATTC
TACAAAGCTGTGGTGCCTGAATATAAGATCGAGGAAGATCTTCGCGGTCGTATCCGCCGTAACGTGCGTGGAGACTGGAGCAAAATGCACCATTTTGCCA
AATCGATCCACAAGAACCAGTACGCCCGTGTGTTTCTGTTTGTCCGGTGGAAGGCCAAAGATGAAATCCATGCTGACTGAACGCCAGGCTTCCGTGACAA
TCGGAAGAGGTCGCATGGGGCTTGTAAGGACGGTGTAGGCTTCGGAAGCTGGCATTTTCACAAGAACGTACCCATTTATGGATGTACTTGTACATATGCG
GCCAAAAAAACACGAGGAACGGCCGCGAACGTCTTTTGGCGACCCTGA