Description :
From Genome Similarity Track
Location :
Scaffold_1673:776- 2051
Sequence
1275 bases(100 bases per row)
AAATCCTGTAGTATCATCGAAAGATATTCTTGAGTAACGGGAATGCGACTCCGGCTCCTGGTCGCGGTATAGTCTGTGACCTGGATGTAGGGAATGCGCG
TCCGGTGGCTCAGTGCGTGAGGCAGATTGTCCCGCATTTGCTGGTCAAGGTATATGAGTTGATCAAGAACTTGAGACAGGCCCGATCGAACATTCCGAAT
CGAAGTAGGCTTCGCCGATTGTAATCATTCTCAACAAGAATGGTGTAGATATTCGCATGTACATCGATTACAGAGCGGTGTTTGACAAGCTATCCCGATG
CCCAATACCCTTGATTGATGATTTTCGGATTGGTTTCGAGTCTGTGCTGTAGTTCATAAGCTTAGCTATGACTAGTTGCTTTTGGGTGGTGCCCATGACT
GTGCGTGCGAAGCTGATATCGGCATTTATTTGCTTTTTTGGACACTTTCAGTGAATCCGAATGTCGTTTGGACTCAATAATCCCCCTCCTTCGTACCAGG
CGGTGATCAACAAATGTTTTTGAGGATTTGTTCGGCTACCACCAGAGGAGGAAGCCCTCGTTGACCGAGATGTTCTGAGGTTCTTGGAGTTGGTGGTGTC
TGACCCTGAATGTACCTGCGTTCAACGTCTTCAACGCACATGCGAATATGGTGTTGACCGCAGTGCACCCCAGCTGGTTATACTGACGTCACAGAGGACA
GTTTTCAAGCGGAATATTCCTACCCCTCCACAATAGGTGCAGCTTATACATTGACGATATCGCCCACGCTGCTTCCACTTGGGCCCATCTATGTAAGGAC
TTGAACCCGATAGAGGTACTTGAATTTCTCTGTGGGTCTCCCGAAGAGTGAATTTGACAAATTGACCATCCCGTACCTCTCACACGAGACTCATGCCGAA
GGAATTCGAGCTCCACCTAAAACTGCGCAGTCGGTCCAGGACTTGTCATTTCAGTCTACGGTGAGGGGAGTTCAGTCCTTTCTTAAGAGCTTGAACTACT
ACAATAAGTTCATTGAAGACCTCCCCATGACGGTCACAGTCCTTTACGAGCTGAACGATGATCAAGTCGGTTCGAGGCATGACCTCACTCAGACTAAGAA
GCCATTCGAAATTCTGAAGCCCAAGATTGTTTCGACTCCACTATTACGACATTCTGATCGAACAAAACAGTTTATCATCATACCGCACTCCAAACTCTTG
AGCGATATGTGCAGTGTTGGGACAAATGCACGATGGTGTCATCCAGTCAGTGCGTTTCACTGGGCGTGTCTTGAA