Description :
From Genome Similarity Track
Location :
scaffold_25:775854- 777306
Transcript NameFunction/comments
g2953.t1 conserved hypothetical protein

Sequence
1452 bases(100 bases per row)
AAGGCGTCCTTGTCGCTGGCGTTGAACTTCTTGTTCTTGTTGCTCTTCTTCTTGGGAGACGAAGCCTTGGTCGGGGTGGTAGCCTCAACGGCAGTCTCGG
CGGTCTTCTCCGCCTTCGGGCGAGCCGTCTGCTCGCTGAACCAGACCTTCTTGGCCTTCACGGCAGCCAGCGACTCGGACACAGCACCCACCGCCGACGG
CGGCAGCAAACCGACGGAGCTGAAAGCCTCCATCTGCGCGAGCGGCAGGACCAGCTTGGCGGCCTTCTTGGTCTTCTTTCCGCGGGCCTTCTTGCCCTTC
TTGCCGGCGCCGAGCATCATGAAGTCCTCCTCCTTGCGCTGGAGGGGCTTCATGCCGTCGAGCTCCACGGGGGCGGCCGCGGTCTCGGCCTTGTCAACCT
GCTCGTCCTTGAGCTCCTTGCCGTACGTCTTCTCCAAGAAACTCACGAGGGCGTCGCACAGGTCCATCTCGTTCTGGAAGGGGTGGATCTTGGCCATCTC
CTTCTCGTAGTCAGCGAGCTTGGCCTCGTACTCGGCCTTGCGGCCTTCCTCCTCCTTCTGGCGCTCGAGGTCCTTCTTCTTGCGCACGAGGCGGATGTTG
TTGTAGTACTTGTCGTTGGCCTCCTTGAAGTCCTTGCGCAGGGCCTTGATGGCCGTGAACTTGTCGTCCAGCTGCTCCTTAATCTCCTTGCGTTCCTTGG
CGAGCACGGGGAACTGGTCCTTCTGGTTCTCCTCCTCGTTGAGGCGGTAGAGCTCGTCGAGCGCGGCCTTCTGCGCGTTCAGCTTTTCCTGCACCGCGTC
GATTTCCTCGTTCTTCTGGGCCTGCAGCGCACGCGTCTCCTTGATGCTCTCGTTCTGCTGGTCCAGGACGCCCTGGTCACCCGAGACGGCGCTCACCTGG
AGCTTCTGGGCCTGCAGCTGCTCGATTTCCTTGATCACGCGCTTCTCCTCGTTGAGCGACATGGAGCTCGTCTCCTGCTTGTGTCGCAGATCGGCGATGG
CCTGTTCGAACTCGAGCTCTGAGCCAAACTTGAGCGTGGCGCGCACGCTGCGCTGCTGCTTGACGGACGCGTCCTTGGCGTCGCGCGTCTGGCGCAGACG
GGCCGTGATCTGGTTGCGCTGCTGGATCAGGTCGTCCTTCTGGCCGCGCAGGGCCGAGAATTGCGCCTTGGCCTCCTGGATCTGGCCGCCGTAGCCGCCG
CGGTTCGTCTTGAGCGCGTCCATCTCGGCGCGGATCACGTTCGTGCGCGCCTGCAGCTTCTTGATAGCGGCATCCAGCACCGAGATCTTGGCCTCGTGCT
CAGCCTTGTCGGGCTTGGGCAGGCGCTCGATCACGTCCGGGATCTCGAGCTCCTGTGGCTGCTCGGCGACGACGGCGGGGACCTCTTCACTACTCATCGT
ATGCGGCTTAGGATGACACGTACAGTCTCTCTATGAGGGGGATTTTGACTGG