Description :
From Genome Similarity Track
Location :
Scaffold_32:77585- 80375
Transcript NameFunction/comments
Phyca_LT1534117228CHXC1

Sequence
2790 bases(100 bases per row)
aatagtgcgaaacgaaaaagctgtcttatgtgtggcaccagcatcggattcctcatgaccggtgagctgggacgccgcaagagctcccgtatgttgttgc
gcaacaatagtcgaggcatcatcggtgcagacttggccggtggtgccggaaaagaagaagatattgaggctttgcgatctcgacagcgggcgctgttcaa
gcgccgtatgaatatgatggcggccaggaaaaacctgtctcaaagacaacggggagcttttcgacgacgtctttggcaacggaaacagttggcagacggt
aaattccactgggtccggcaaaacagtacggatgtggtggatgtagtgcctgaggtgcagactggagatgcagtacaatccgtattgacatcgactgaaa
cttcatcgttagctggaccgaacggggagcgagtcacggattaccacaacttccgttcacagggtttcgtgtcaatgtatgacgcttccggtcggttaac
gtggacccaggctgatgaagtgtccattgacatggaatcgtttgacaagattcgcaatgggctggagcaactggactttgaggtaggtgatcgcaacacc
tcagttttcacttgttactcttgtgaaactaatttcttggtgcagggagggggtgatggctcttgagttccgcatgaagaagcagtggttcttggtgcaa
ttgtcccgtattgcgactcctgtgactgaagccgtagcaaagctgagtacgtctgctgcatagtcaccgttttgctcttgaaaaaactaacttttgcgat
taattgtcgatatgcagcggtgacgagagagcgaatcatcaagcagtcgctgcaacttgctgaggctgcacctgatgctcttcacgcgtatctaaagatt
actttcgagggtgaacctggcatcgacgcgggaggtttactgcgtgagtggtttgggattgtctgcaaacagatttttagtgagaaaatgggtctcttca
tcccgaccaagggtgaggacatgagctactggattgatccgctttctggcgagaagaacgatgatcacttgaagctgttccgtcttgctggcattttgat
cggaaaagcgctttttgaaggcctcgtgcttgatgtgcacttggctctgccattacttaagcacgtgctgggtatcccgatctcgttctccgacctcgag
ttcctcgacgaagagctgcatcggaactgcaagtggcttcgtagcaacaataacgcggatgctctttgcttgacgttcagtgtgatgcttgaaaacggta
ctgaagtggatctcaaagaaaatggacgcaacatcgacgttacggacgagaacaaggaggagtatctacgactgattcttgaacaccgcatgcttgacag
cattgccgaccagttgcaggaattcctcatgggaatttacgatgtggtgccaaaagctcttctctctgtgttcgactaccaggagcttgagctcattctc
tgtggcattcccactatcgacacagcggattggcggtcgaacactcacgtgcgctacattaagccggatgaaaacaagaaggccaaaatcactgaagaag
agcagaatggggtactggagtggttttggattgttgttgagggtcttgcaccggaggagcgagcgaagctcctgcaattcgtcactggtactagtcgcgt
acccgtggagggattccgtggtcttatgagctcgagtggcatcattcaccagttcacaattcaactcgtgccacgaggtaaggaaaagtctgacctgttc
ccaaaagcgcacacctgtttcaacagactcgacttacccatgtaccgcgatatggaggagttggagacgtacttgacgatggtgtctcaaatggaagtct
tcggctttggcctcgaatagggcatgaagtaaaaagttgcccgctcaatatatgcatgcgaggagtagcaagctgtacattctcgaacaatttgaagcct
cttgaaaactttcctgcatacacacgtacattacttagtctgctccttctgcttggcaatgtacgccgcaacgtcttgctgcagcatttcctgatggcgc
ttatctctgcgcccctttgtgccgtccgacgatgaactaagccagctcgcagaagcttcctgcttcatttcttcgggttgctccttagacttgagcagag
ccagagctgcttcgatcttgctctcgctcggagccgatcccaccttaaatggcgtctctatttttcccttcctcgtcttctcttctgcagcagcagccat
cttagcagttttttctcgactagtaatagcctcctcttccagtcgtcggagccgatcgcgcatctcctggatcgcagcagccagcaccatatccttgctc
tctcgctcgtgcatggcgctcaactcgttctctacctgttctagacggatttcctcattctcacgttccatacgtcgcttcaccgagtacaagtacaacc
ctagtagtgtaccgggaccaaaggcaaagagtccgtagaaaagcttacgctttggagacaacagatccctattgcgtcgtatcaaagcgtcacggttaag
acaaaaatatacctcgttatgcatgtgtggtagtagtggttttacgcactcaagcgcgcctgggggagcatccgagaagagcatcttgacacgaccggcc
gccatgattgccagggtaattgaaaagcagtttgctaaggttcgctctgaaggggttaaagattaggttcgctttccgttttgagtttta