Description :
From Genome Similarity Track
Location :
contig_27:775718- 778518
Transcript NameFunction/comments
g7435.t1hypothetical protein

Sequence
2800 bases(100 bases per row)
ATTTCGAAGTTGTACAGAGGGCACACGAGCGAGAGCATAGCGATGCCAGCGGACGCCAGACAGATTCCGATCAGCACCATTGAGCTTGATTCCAGCCACA
CAAGAGCACAACCAGCAAACGTCACGAGGCATGCGACCTCGATTGTCCAGCGACGGCCAATCACGTGCGCTAGGCCGCCACTCAGAATGACGCCCACCGC
GCCAGCGGCGGCAGCGTATACCTTGATCATCGCCAAATCCAGTGCACCATCTAGGGTCTCGTTGTTGAAGTAGGTGAACGACTGGTTCACAAAGTTGTCG
GAAGACGAGTTTACGTATCCCAGCGAAAAGATGAGGCACGTCAACCAGCCATACGTCCAACCTCCCAGACCACCCACGACAACACTGAGCGAGGCCGCAA
ATTCACTTCCGGAGCTCAAGGCACGCGAGAAGCCACCGTTGTACATCATACGCGTCTGGATCGTCTTCATGAACGGGAAAGCCGACAGCAGCAAAAGCGG
CACTGCCAAGAACAAACCAACGATCACATCAAAGAAGAAGGCAAGTTCGCGAACGAGACCCCACTTAGCAACAGGCAGACCGAACAGTCCGTGTAGTAAT
TGCAGATAGTGCAGGAGAGAAAAGAGCCCCGTAAAAATGGCAACCGTCAACGAGAAGGACTTGATGCTGTCCCAGTCTTGCATAGATCCCACCACAAATG
GAGCAACTCCAATAATTATCACCATCAGCACGTACAGTACTGCACGCGGAACACGAGCCGAGTTGCGCAAGCACATACCCAAACCAAAACCGCCGATCCA
TAGCACAACGGAAATGCCACCAACGCAAGCCAACAGCATCCCGATGTCGCTCAGGCTGAACGAGAAGATGAACACATAATACATGACCAGCGGGTGGCGT
AAGTCACGAACTGCGTAGACAAAGCGGCTCATCGGACCAATCGGGTACATGAGGCTGGCCTCATAGTTGTAGAAATCGTTCCACGTGTCTTTCGGGCCTG
CAGGACTGCTGCTCATGTGGTCCGGAAGAAGCCTTTCATCGCCGTCTGCCTCTTTGACAGACATGAGCCACGAGAGCCAGTAGGAGACATCCACCATGGT
CTTGGAGAAGTCCAAACCGTCCGTGTTGAACAGGAATGGCGCAAGCAGCCAACATGCGCCGAGCAACCATACCGCAAACGAGGCAATGCCATAATCTTGA
CCCTTAGAGCTGTACGAATTCAGCAGCGTGATGTTCGACGGAATCTGGTCTGGGTTGGTGTCGCAGTCAAAGTCCGCAGTAGCACAATACTCGGCCAGTA
TGTTCGTACCGATGCTGAAGTTACCGTACGTACCAAAGATAAGCATTAAGCCCATAAGCTCCACAGCCTTGCGATAGTGAGAAGCGGCGTATTCCTTGTA
GAAGTTCACCATCGTTTCACGAACGATGGCGAAGCCACGACCGGTACCTCGGTACTTGGAGCCACCACGCATAATAGCAACGTCGTAGAAGTGCGACTTC
GTACCAGTCTCGAAAATGTAGAACACTGGGCCAAGAGTCACAATCAGCTCCACGAAGTTAACCACGGCTTGGTGCCAACCGTACTCCACGAAAAGTGTAG
CGATCAGCGGGATAGTCATCAGCATACCGAACTGGAAGATAAACTGCGTGTTCATCACCTCTGCCAGGTCGTCCAGGTAGCTCGTTGTGATGATGGCTGA
TTCCTGGATTTCCTGGTGAAGCACGATGTAAACCTTGCCGTACGCGTACGCAAACACACAGAGTACCACCAAAGCGTTACAGATGTAGAAGCCCATGTGG
CCGTAGAACATCGAGTTCAAGCGGAAGAAATCCATGCCAGCACCCATCCGGTGCGACTCGCGACTTAGGGAGCTTTCAGCACTACCGTTCGACAGCTTAG
CCTCGAAAGCGTTAATTTGACTCAGCGTCACATCACGGCCCTTACCGCACTGCATGAACTCTTGGTGAGTAACGTGTTCGCCGCGAAGGGCTGCATTGTA
TCCAGCGAACACATCTTCGGACAAATTGATACCCTTGCTTGCCTTCGATACACCGCCATTGGACATCACAAATGCCTTCTCGAACACATCGGGGTGACCG
TAGTGCATACGACTCTGCAGGGGATTCGCCAGCACACGCTGCGTCAAACTCACGAACACCAACTCCTGCAACGTCATAAAGTGTGCCAAAGATGATGCTC
GGCCCGTGAAAATGTGCTCTTTCATGCCAATAATGGTGACATTCTTTCCGTTTTCCGTAGCCGTCGCCAGGAAATTGGGGATCTTGAGCGCTTCTTCGAA
GTAGTGCTCCTGGTTCATATCAATCGTCTGCAAGTACTCACCGCGTGTGAAAGGCAGGGCAATGTTCTGGTTCTCCGGCTTACCCTCGCCAACTAGCGGG
TTGCCAGGAAGCTCATAACGGTACACCTCAACAATTTCATCACCATCCGACTTGACCAGTACGCAGTCAAAACGAGGCTCCGTGCCGCTGCCTGCGGGTG
GGCGGATCGTATCCACGTAGCTCACACGCCAGTTCGGGTACTTGCGCATCAGAAGGTCAATATCTGCCGCGCGTGAATCTCCAGCTGCAAGTTGATCGGC
GTAGATCTGGCAACTGGTCACGTACGAGAACTTAAGACCCGCAATGCGATCCATGTGCTTGATTTTTTCCAAGTGAGAGATTTTCTCGTCCGAGCCAATC
TCGAGCCAGCGCAACATCTTGAGTGCATCTTCATACATCATCATACCATGCACTGTACGTGCCAAGGTCTGTCCACGCATTGAAGCCCAGAGGCGAACCT