Description :
From Genome Similarity Track
Location :
contig_87:77544- 79277
Transcript NameFunction/comments
g12932.t1ETI46398.1 hypothetical protein F443_09210 [Phytophthora parasitica P1569

Sequence
1733 bases(100 bases per row)
ACTATCTCGCTTAACGGCGTCCCGTGTGGAACTTCCACAGGATGAAGGCAAAGATGGCCTGGAACGCAACAATATACACGACCAACAACAGCATGTCGCG
AGGAACGTCCACGTCCTCCATGCCGTACTTGGCCAGAATGGCCTTCGCAGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAACGACTCGAACGAG
TACGAGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCCGGGATGGAGGCGCGAGGCACCATGAAGCCCTCGCACAGCATGAACATGCCGAACACGC
CCGCCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCGATCACGTGCATCATGGACTCGGACACGACGAGCGACAGGAAGAGGTTGAGCAGGA
AGTACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAGCGCCGTCGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAGGAAGTTGGCGCA
CACGTAGCTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGCGAACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACCGACATGAACACC
AGGAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCCGTCAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGAAGCTCAGGCAGA
AGTACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGTTGTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCAGAGACGAGGGCGA
CGGCTGCTCGATGTCCGGCAGGTGCTGCAGCGTCTTGCGGTCGCTCTCGATGCGCGTGCTCAGCTCCTTGCGGGTCTCGCTCTGGGCGTAGGCCTGCACG
AGCTTGGGCACGTCCGCGTGGTCGTCGAAGTCCGTGTTCACGAGGCTGATGAAGTACTCGGCCGGGTTCATGTAGTTAGGACAATCGTAGCCGGACGACG
CAAAGTGCGGGATCATCTTGGCTCGAGGGCCGCAGTAGACGGTCTGGCCGGCCGACAGCACCACGACGTTGGTGAACATGTCGTAGACCAGCGACGAAGG
CTGGTGGATGGTGCACACGACGGTTTTGCCCTCGGCGCAGAGCTTGACGATGAACTTCATGACGTTGTGCGTGGCGCTCGAGTCCAGGCCGCTCGTGGGC
TCATCCAGGATGAGGATGCTCGGGTTCGACAGCAGCTCGATGGCGATGCTAAGACGGCGCTTCTGGCCGCCCGAGAGGCCCTTGCGGAAGATGTCGCCCA
CGAGTGTGTGGCGGCACGTGGCCAGCCCCATGGCCTCCACCACGTCGTCCACGCGGGCCTCGATCTGCCTCGTCGAGACGCTCGTGGGCAGACTGAGCTT
GGCGGCCATGCGCATGGTCTCGAGCACCGTGAAGGACCCGAGCAGCGAGTCCTCCTGGGCCACGTAGCTCGTCACGGCGCGGAACGTCTTGGTCACGCGG
GCCTCACCGTTGAGTTCGATGTCGCCCGTCACTTCTCCGGAGCTGATGCGGTCGGCCAGCAGGTCCACGAGTGTGGTCTTGCCCGATCCGGACGGGCCCA
TGATGGCCGTGAGTTCTCCAGGCGCGCAGCGGCCGCGGACGTTGTCCAGGATGACCTTCTTGCCTGCAGGCGCGTCGGCCGTCGAGCGACAGGCGACAGA
GTAGCTGAGGTTGTTCCAGCTGAGCACGCACGG