Description :
From Genome Similarity Track
Location :
scaffold_27:775359- 778159
Transcript NameFunction/comments
g12087.t1 hypothetical protein PHYSODRAFT_564300

Sequence
2800 bases(100 bases per row)
ATTTCGAAGTTGTACAGAGGGCACACAAGCGAGAGCATAGCGATGCCAGCGGACGCCAGACAGATTCCGATCAGCACCATTGAGCTTGATTCCAGCCACA
CAAGAGCACAACCAGCAAACGTCACGAGGCATGCGACCTCGATTGTCCAGCGACGGCCAATCACGTGCGCTAGGCCGCCACTCAGAATGACGCCCACCGC
GCCAGCGGCGGCAGCGTATACCTTGATCATCGCCAAATCCAGTGCACCATCTAGGGTCTCGTTGTTGAAGTAGGTGAACGACTGGTTCACAAAGTTGTCG
GAAGACGAGTTTACGTATCCCAGCGAAAAGATGAGGCACGTCAACCAGCCATACGTCCAACCTCCCAGACCACCCACGACAACACTGAGCGAGGCCGCAA
ATTCACTTCCGGAGCTCAAGGCACGCGAGAAGCCACCGTTGTACATCATACGCGTCTGGATCGTCTTCATGAACGGGAAAGCCGACAGCAGCAAAAGCGG
CACTGCCAAGAACAAACCAACGATCACATCAAAGAAGAAGGCAAGTTCGCGAACGAGACCCCACTTAGCAACAGGCAGACCGAACAGTCCGTGTAGTAAT
TGCAGATAGTGCAGGAGAGAAAAGAGCCCCGTAAAAATGGCAACCGTCAACGAGAAGGACTTGATGCTGTCCCAGTCTTGCATAGATCCCACCACAAATG
GAGCAACTCCAATAATTATCACCATCAGCACGTACAGTACTGCACGCGGAACACGAGCCGAGTTGCGCAAGCACATACCCAAACCAAAACCGCCGATCCA
TAGCACAACGGAAATGCCACCAACGCAAGCCAACAGCATCCCGATGTCGCTCAGGCTGAACGAGAAGATGAACACATAATACATGACCAGCGGGTGGCGT
AAGTCACGAACTGCGTAGACAAAGCGGCTCATCGGACCAATCGGGTACATGAGGCTGGCCTCATAGTTGTAGAAATCGTTCCACGTGTCTTTCGGGCCTG
CAGGACTGCTGCTCATGTGGTCCGGAAGAAGCCTTTCATCGCCGTCTGCCTCTTTGACAGACATGAGCCACGAGAGCCAGTAGGAGACATCCACCATGGT
CTTGGAGAAGTCCAAACCGTCCGTGTTGAACAGGAATGGCGCAAGCAGCCAACATGCGCCGAGCAACCATACCGCAAACGAGGCAATGCCATAATCTTGA
CCCTTAGAGCTGTACGAATTCAGCAGCGTGATGTTCGACGGAATCTGGTCTGGGTTGGTGTCGCAGTCAAAGTCCGCAGTAGCACAATACTCGGCCAGTA
TGTTCGTACCGATGCTGAAGTTACCGTACGTACCAAAGATAAGCATTAAGCCCATAAGCTCCACAGCCTTGCGATAGTGAGAAGCGGCGTATTCCTTGTA
GAAGTTCACCATCGTTTCACGAACGATGGCGAAGCCACGACCGGTACCTCGGTACTTGGAGCCACCACGCATAATAGCAACGTCGTAGAAGTGCGACTTC
GTACCAGTCTCGAAAATGTAGAACACTGGGCCAAGAGTCACAATCAGCTCCACGAAGTTAACCACGGCTTGGTGCCAACCGTACTCCACGAAAAGTGTAG
CGATCAGCGGGATAGTCATCAGCATACCGAACTGGAAGATAAACTGCGTGTTCATCACCTCTGCCAGGTCGTCCAGGTAGCTCGTTGTGATGATGGCTGA
TTCCTGGATTTCCTGGTGAAGCACGATGTAAACCTTGCCGTACGCGTACGCAAACACACAGAGTACCACCAAAGCGTTACAGATGTAGAAGCCCATGTGG
CCGTAGAACATCGAGTTCAAGCGGAAGAAATCCATGCCAGCACCCATCCGGTGCGACTCGCGACTTAGGGAGCTTTCAGCACTACCGTTCGACAGCTTAG
CCTCGAAAGCGTTAATTTGACTCAGCGTCACATCACGGCCCTTACCGCACTGCATGAACTCTTGGTGAGTAACGTGTTCGCCGCGAAGGGCTGCATTGTA
TCCAGCGAACACATCTTCGGACAAATTGATACCCTTGCTTGCCTTCGATACACCGCCATTGGACATCACAAATGCCTTCTCGAACACATCGGGGTGACCG
TAGTGCATACGACTCTGCAGGGGATTCGCCAGCACACGCTGCGTCAAACTCACGAACACCAACTCCTGCAACGTCATAAAGTGTGCCAAAGATGATGCTC
GGCCCGTGAAAATGTGCTCTTTCATGCCAATAATGGTGACATTCTTTCCGTTTTCCGTAGCCGTCGCCAGGAAATTGGGGATCTTGAGCGCTTCTTCGAA
GTAGTGCTCCTGGTTCATATCAATCGTCTGCAAGTACTCACCGCGTGTGAAAGGCAGGGCAATGTTCTGGTTCTCCGGCTTACCCTCGCCAACTAGCGGG
TTGCCAGGAAGCTCATAACGGTACACCTCAACAATTTCATCACCATCCGACTTGACCAGTACGCAGTCAAAACGAGGCTCCGTGCCGCTGCCTGCGGGTG
GGCGGATCGTATCCACGTAGCTCACACGCCAGTTCGGGTACTTGCGCATCAGAAGGTCAATATCTGCCGCGCGTGAATCTCCAGCTGCAAGTTGATCGGC
GTAGATCTGGCAACTGGTCACGTACGAGAACTTAAGACCCGCAATGCGATCCATGTGCTTGATTTTTTCCAAGTGAGAGATTTTCTCGTCCGAGCCAATC
TCGAGCCAGCGCAACATCTTGAGTGCATCTTCATACATCATCATACCATGCACTGTACGTGCCAAGGTCTGTCCACGCATTGAAGCCCAGAGGCGAACCT