Description :
From Genome Similarity Track
Location :
contig_2:775349- 776407
Transcript NameFunction/comments
g685.t1RAW41454.1 hypothetical protein PC110_g2341 [Phytophthora cactorum

Sequence
1058 bases(100 bases per row)
GGGAACGGATGGTGCAGGATTAAATCGAACTGCAGCGCCTCGATCACGTAGAATTCACACTCGAGAATGTCCTTGTCCTGGAACATGTACATGGACTCGT
CCTCATCGACGCCAGCTATTATAATAGCGTTGTTAGTACAAAATATAGCAATGTGTAGCAAATCGTAAGTAACCAAGACGTTTGCGAGCATGAATATGCG
CTTGCTGTAGCAAGGTTGTCGTACTCGTGGTGTAATGATGAAGAACGGACGCGACGGTCGTGAGTGACAGCTGACTCTCCTCGACCTTGGAAGCGAGGAA
GAATACCGTTCCAACCACCAAGTGCGGATCGAAGTTCACGAAACTCTGCCTACAGTTACATTTCAAGTATTGCAGCACGCAAACAAATGTTAGCTACTGT
AGCGCACTTAAAAGTCACAACACGAAAACCTTGTCTTCCTCACGTTTGATAGAACCGGCGGTAGAAGATGATTGCCGTATAAATAATGATTTGGCGAACC
CTCAAGCGGGGCCCAATCTCCTCCAACACTGCGGATCAAACAGAACCAAGAAAAATCATCAGTTCCGTCACACAAGGACGTCCAATAAACCAGCGAAGCT
TCCGTTCCTGGCCCTACAAAGCTGCGGAGGCCGTTGAACTTGGTCTCTACGCACATGAAATGTTGGCGAGGTGGATGCTGTCGACCTCGTCGTCCGTCAG
ATGCTTGCGGTCCAGCGGGTTTCTCTTGCGCAGGTCCGCCTTGGCCACGTCCTTCATCCAGTACAGACTGGCACATTCAAAGAACAGGACGTCAGCTCCA
TCGCCTCGAGGTGGCCATACGCACACGGCCACGTACTAGTGCGTCGAGTGCCAAAAGTTCATCCCCATGGTGCCGCCCGCCGATAAGTATGGAAGTGCCA
CGATCCACGCTGACTGGTTGAAATCTGATCTCTTTTCCACCAATCATCTGGTAGTTTATTTCCTATTGACAGTACCGGACCATATATCCTTCTCAATATA
CTCCCTCTATGTCACGGAGGAACGGACAGCATGTTGAACTGAGCCATTTGCTGATCGA