Description :
From Genome Similarity Track
Location :
Scaffold_301:77520- 78627
Sequence
1107 bases(100 bases per row)
GCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATACATATCGAGAACAGTGAACTGTTCGAGGCTG
TCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGC
TTTCTTGCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGG
GTGATCGTACCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGG
TACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGG
CTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCATCTTCCCACAGCCG
AAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCTCAGGCCAC
GCTGAGGCCGGCGTACGGGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAG
TGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACGGTCATCTTGATGTGTTCGTTGGGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTC
TTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGC
TGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACGCTTAGCACGACCGCTAAGGCTGGAGAGTGCAA
AAGCAAC