Description :
From Genome Similarity Track
Location :
Scaffold_11:775124- 777312
Sequence
2188 bases(100 bases per row)
CTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTTGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACAGTGTGAGCTCCGTGGA
CGCGTGCACCGCGTTGTTGAGCGTAAACTGAACACTGGAAGCTGCGCCGACCACGTACATGGTGCTGTCGCGCACACACTGCGCAAAGTGTCCTCGAGCA
CTCAATTGACGCGCTCTGTCTGGCCGTCCGTCTGTGGATGGTCCGCAGTGGACATCTGCGGACGGGTTTCCAGTAAAGGAAACAGCGTTTTCCAAAACGC
AGCCGTGAACCGCGGGTCTCGGTCCCAGCCAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTTGTCGCTCGTA
ACAGTGACGAGAACCAGAGCAAAATGTACCATCTTGCTCAGCCGACACACGAGCACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGA
TGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGCTCGACCCGCTGACATGTTTC
ACATGTCTTAACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCCGAAGGCGACATAAAGGTCTTCTCGCGGTTCAAGTGGCCGCTGGAGGGCGCGT
CGTGCGCCTCCGCGAGGATATCGAGCTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGTTCACTGGGCTCCACCCGGTAATAGAGGAGGCCATC
CTTCAACTCGTATCAGTGAAGCCGTGAGCACTGTCGCGACGAGAGCTAGTCGGACTTCGCGCTCGTTCCTACCATAAGGAACTTGACGATAGGCGCGACA
GCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCGACTCATTGTCAGTCGCCGTCCTCAAGGATG
CGTGGTCTGTGTAGATCACGAAGGGCTTCGAGCCCAGAAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGCCGTGGACAGG
GTAGCTCCGCTCGGCTGCTTTGAGCTGCCTGGACTGGAACGAGATGATTCGTTCATATCCAGCCGTGTCGGCCTGCAGCAATGCACATCCGATGGCGGAA
TCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGATGTCAAAAGCATCCG
GGTGCCCATGCTTCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTT
GGCCAAGCCCAACCACATTTGAAGATCCTTTTGGGATCGGAGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTG
CTTACGAAGCAACCGAGAACTTATTATCTCTGATGACGCGAAAACACACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCACATCACGTCCAACACTCGA
CGGAGGTGCCCCAGATGCACCTCCATGGCCGTCTTGCCCTCTCGGTACGGCTATGGACGAATATATTGTCGACGTACGTCCGTACGAAGGTACGCAAAGG
GCGGAACAGTTGCGCCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGTGGCATCACGAACCACTCCCAAAGCATGCCGCTTGGGGTGCTC
ACCGCGGTGAGCGGGATGTCACTCTCCCGCATCAGGATCTGGTAGTATCCCTCCTAAAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTTA
ACAGCACATCCTTCCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGCTCAGCTTGTTATTAGCGTGAACCAGACGCCACTTTTCGCTCGGCTTTCG
AACGCAGAAAGTCGGCGTCGAGTGCGGAGATTTCGGCTCCCGCACCATGCCTGCTTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCG
CGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTT