Description :
From Genome Similarity Track
Location :
Scaffold_260:775- 8566
Sequence
7791 bases(100 bases per row)
AACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTCGGGGCTCCGAAGATGCAGAACTTGGTGAAGAT
CGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGAT
CGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTG
ATCGAGAGGAGAAACGATCGCCGGTCAAGCACTAATATCCGGTCGATCGAGGACTTGCACACAAGAGATAGATCACTAGAGTAGGTCAAGCTGGCCAATG
AATTAATCCAGTCTTAACCGTACCGCTAGTTCACTACCCAAAGTGTCGACCCTGCCGAGGCCAATGTAGTTCCTGGGACTTGGTGACTTGAGGGGACTTG
TGCTCTTCGGTGCAATTTCTGCTCGAGAGCGACTTGCCGGGGCTTGGTGGTCTTGGATCACGCGTGGGGTCAAATCTGTTCTCCACAACGCAAGTCGATC
GAGGCCAATATGCTCTTCCTCCTCGAGATTCCAGACCACTTGCGCTCCACGGTGCAAATTCGACTCTGATTTATGTTTAGCTGGTCTCTCCCTAATGCTA
CCATCTTGCTTACCCTCCTACAACCACACGATTACTGGATTCTTGCCCCGACTTCGTCCTTCATGTGCGTCCCATCCTGGTCGATCCACGATCGGCCCCG
ATCGGCGATCGACTCCGATCGGCCCTGATCGGCGATCGACGATCGACTCCCGTCGGCCCTGATCGGCGATCGACCCCGATCGGCGACCCACGATCGGCTC
CCGATCCACGATCGACCTCGATCGGCGATCGGCGATCCACTCCCGATCGATGACTTATGCCGGTTGCCATGCGCCGCCGATCTATCACCTTCTGTCCTCG
GCCATCTCAGATCCGCGGGTTCTGTCGTCGATCTGGACTTGGGTCAGCCACGAATCACGCCGCGGTTCGGGCACGATCACCCACAATCCGGCTTGCCACA
TGTCCTGCCTTACGCGCCGGCGTCATCGGACCACCTGAGGTCTCCCGAAGAACTCCTTCCGATCCGTAGATCCTTGCTGCCAGTCTCTCGATCGCCGATC
TCCCACGCCTCCAGTCGATCGGCCCAGCCGCCTTTCTCGGAGAACAATTCTTATTCAGCACTTCTCCACACCTACCCAAGACAAGCCCATGCCGAGACTT
GCAGGCATGCACCAAAAGGTATGGGTCTGTGAGCGTCTAATACACGAGCGGCGCTATGGTCACATTACTGGTTATGATAATGCGCGGTCCACCTCCCGCT
AATTTTCAGAAATTTGCATTAGGTTGAAGCGCTAAAATGTGGTGCTCATGTTGCACTTTCAAACGTAAAACCACGCGTGACACCCAATCGAGGCGCGAAC
GCGTTCGCGCGCGAGAATCGACCTACCACGCACGAAATCCGCAAAGCAATTTGATTGGCCGAAACCAAGTCGGCGGGATCTCGAAAGGTCGCCACGGTCG
TATGGCTTGAAACGGCACTTTCCCCCGAGGTTTTTCTTATCCCTGCAAAATCGGGATAACGGTCGCCGGTGGGTTAAGCTGTCCAGAATCAGTAGTTTGC
ATCCGTCGACTGACGGCTTCCAAACCTATAGTGAAACCAAGTCAAATTAGTAAATGTCAACACACGTAGCATACCAAAACACGTACCCTTTCGATCCAGT
CCAGCATGACCGTGGCGTCGCAGTACGCGTTCGTCTGCACGGTATGCTCGACGGACGCCGCTCCAAAAGCAGGGTTGAACACCTCTTGGGATACGGGTCC
GCCGGGCACACCTGCAAAAACAACAAACGGAGGCAGCTCCTCGCCCGTGGCCGACGCAGCAAGGAACACGGACACTCGGAAGCCGTTTATCGCGCTTCCT
ACCGGTACGTTCAAAATGTTAGCAAAGCGTCATAACGTACTGAAAATGACATCCTTACCTTGCACGACGTCGACCGTTTGAGCGCCCACAAAGTCAACCG
TCCGGTGGAGTGAAGCGCTGCGGCTACGGCTTCTGTGAAGCCACAATACGAACGTAATTATGCCATACGAGTACACCTCTCTCAACTTCGTGCTCAACGT
TGCCTTATCTCTTCGATGAGTTCGTCCACTGTGTCTGCTCACTAAGTACGGCCCAACACCACTAAGTTCGTTTCCATCCACTGTCCAACAAATTCGTACT
ACATATGAAGTTGCATACTAAGTATTTCTATATAATGAAGCATTTCCTAGTCCTCTTCACTTTGAAGGAGTCGTATTAGAAGTTACTTGTCTCTGTTACG
CTAAACTTTCCTGAGCTTATCTTAAAAAATATTCACTCAGATCACCAGACATTTGTTGAGGGGTTCTGTGGTACTATTGGCTCAATGTTCTCTGAAATTT
ATTTCAGAGTTAAGGGACGATTGGAATCATTCACTGACCTGATTAATGGCTTAGCGCATTCCTGACCAAGTCGATCCATCAACTTTCATCGATAAACGAG
GTTTGTTTTTTACAAATATCATGCCAAACTGCAGTACAGTGGAGTAAAAGAATACACATACCCCGCGTAAGGTGATATTTTAGGTGAATGTTACCTGTGG
CGGCAGGTTGTGTGGAGCCCCCCCAAATAGCTACATTCGAGCGAGCTAAGTCGAAAATTTGCGTTTGCCGATCAGAATTTAACGATAGAAAAAATAGATT
ACCGAGGTGGCTGCCTCTACTGTACAGTAATGTGCGTCAATAGGGACCTCTGATATGAATAGGAGTGTAAAGGCTATTAAGGCGAACAAGTGGAAAAAGA
AATAACAATGTATTGATTTAGTCAAGAATAAATGACACACTGCTTTTACTAATGAGCGTGGAGTGCAACCAGCACTTCTGCATCGTAGAAGCTGACACAT
TATCCCACGCAGACTCGCACCACTTCATGGCAGTTAGTAAGTCGACTGTATGTCTAGGGATGCCCAACTTCTTGGCTAGCACCGTAGCATAGAAGACGAT
CATTGCACCGCTGAGGCAAATGCCCTCCGCCTCTGCAAGCATGATGAACTCGACGATGTTTTGATCGATCTGTAGCTGGAATGGAGACGGCTTGTTCTTG
AGCTGAGCACTTTCGTGAGGCTGGCGCAACAGCGCGATACGCCCCGAGATGATGCGGCCGATGGTGGCTTTCCCAGGGGGCCTTTGCGGACCGAACTCGA
CTTTGGCCCAAAAGGCCAGGTCTTCATACTTGACAGCGGGGGAGCTCTCAGCCTTCTTGATCAGAAGCAGCTTCTGCTGCTGGGTGAGGCGAGTTCTAGT
CTTGGAGGAGGAGCTCATGAGGTGGGTGGATGGGTAGGGCGCTGGTGTTGTGGCAGATTCCGTTGTGCTTGGAGGAGGGAAGGAGTTATGTTCGCGCCCG
AATTCAAATGGTAACTTCAATCACTGATTGGCTAGATCTGACCTCACTAGCCAATCACGTAGTCGCGCTCGTTGCGAAACCAGCCAATAGCGCCAGGATC
CTGTCGAAAGTTAACTTAAATCAATGTTAGTTGTGTTCTTGACTGACAGCTGTATATAATGTATGTAAGGATATTAGTCGCACGGGGACCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGTGACCGCCAGCGACACTGTGCAAATTGCCGCAGTTTTTT
ACCCGCCGCAGTGGTTGACGGGGAGGCAGACTGTCCAGCGGACAAGTCGCTCTGGACACGCCACTGACGCCGGACACGTATGCGGAGTGGTAAGTCTCGA
CATACATTCACGGTGAACTGCTCAAAGAAGCGTCGTAGTGCCCCGTGCACGCGGTGGCACTACAAAATGATGTGGTGGGCTTCTTTCATGGATACAAAGG
AATTCCACGTGCAGGGGCGCGTGCCGGAGCAGTACTTGCCCGTCATGGCGTACTAAGTGGGAGCCTGTGGGGAACAAGTTTCTCACTCCCATCGCCATCA
TGCACTCACAATATTGCTGCTTTTGTCGCCCTTTATCATCTGCTCAGCGCTGCAGACACACGTGGACTCAGAGGCATCCATGTCGCTGGGGACAACGAGC
TGATCCTGCGAGTACTTAAAACTCGAGCGCCACCAAAAGCAAGACGACTACAAATGTGGTTTCTTAAGTGCAGACGTACCGCGGACAGAGTGCGAGTCGC
GTCATGGACACTCTTGAGCAAGTCGGGGAACGCTGCAGCGCGCACCCTGGCCTTGACAGTAACGGAGGAAGAGCTGACGCACGACCTCGAAACAGAGGCA
ATTCAGGCAAGATTCCCACATATCGACACACTAGTGTCGCGATGTATGCTTGAGTGGGCTAACACGCACACAGATGCAACAGAGGCACTAATAGATCAAC
ACCTACAAGGGAATAGTGGAGAGGAAGCGGCCGAGTGTTAAACCACGGAAGTAGGGTTGCTAGGACTCAATCCTCGTTAGGAGAAGTTGTCCAATATACC
TCATCATCTCAAAAGTGCCCAGCGGAGGGATGCCGTACGATGAGTCCATTTCAGCTCATGACGGTACCAGTGATTTTCCCGAGGAGACCTCTGAGGATTG
CGAGTCGCAATTTGCGACAGCTGAGGGTGCGAACATGTTCTCCTCCTTCTCGTTTCGTTAGTTGGTAGCTCTCTATCTTCGTTAGCACTGTGAGTACGTG
GTAGTTGCTTGTGTAGCTTATTCCTGAGCGACAATAGCGGCATTGGCGCTGACAACAAGCGCCCCCAGGAGCAGGTAAACTGTCTGCATGTTGAATTGTG
TAATCCGGCGTGTTTCCACTCTGAGAAGTGCTGTGAAGAGGATAGTATGTCCATTGTGATCAAGCTGGACAAGGTCATGGAGAGGAACCCGAATTTCGTG
GAGAAGCTGAGCGTGGATCTTGCAGCGATTGAAAAATTGGATAAGAACGCTGAAATTGCTGAAGTGTCGAGGAGAAGAACATTTCAACCTAACGTGCATC
CCTTTCCTCTTTTGCCTCACCAATTTTTTTTTTAAACCTGAAATTTCAGAGCTTCTTCGGGCCGGAGGCACACCCCACAATAATGCGCAATTAATCAATG
AAAACAACGTCTCTCAACATTGAAAATAGGGTGGTGCTACAATCATAACATTGCTGTAAAGCGCAACGAGCTGAGCGGTACGCGGTTAAATCAATTTAAA
GCAAAAATAAAAGCTAAATACGCTGAAAGAAATATGCTTAGTCTGATTCGATAGATAAAGTATTGAATAGCCACGATAGCTAGATGATATATTAGACTGC
ATTTCATCCAACTTTACCTGGCCAAACCTCGGCAGTAAGATCGGATCAAAATGTATAGGCTACCGCAGCGATCAAGTCGGTGGCGCAGTTGGCACGGAAC
GGCGCAAGTAGGGACACGAGTTACTCCTAATGCTGCGGCTCCTGCTAACCAGTGGAGCTGCAGTTGCCGTCATTAAAGTTGTCGTTAAATGGGCATCTAG
TTTGTCGTTATAGTTCACTTGATTTCTGCCTGATCATCAGGATTCCGTTACGCACGGGGTACTATAATCTTACTTTGCGTTATCCGCAAGATTCATTGTC
GCAGTCATCACGTTGACTGCGACCAATACCGGTAGTACTGCTGATAGGCTATCTATCAGTGATAGCTGGGGCGAAAAGTATATTTTGTGGTACCATTATT
ATAATAACGTCGTAAGACTGTGTCAACGGAGCAGCAGGCGACGCCGCTCATTCGAAAGTTTGTTGTGAAATCTATTTTGTCAGCGCTGTGTTGCTTGCTG
TGGACGGAACAGCCGTGAAGGTAGGAGCTTGTTGTCTCTTGAGGAGAGAGAATGGTGTTGAACATGGTACTTTGTTTGTTGTTTTACAGGCCCTACCTAC
CCTGGTACAAAGCTTTCAAAAACTAGACTCGTTCGGGAGACAAGTCGCTCCAAGACCTTCATCAAGACGCACAAGAATAATGACGATAACCTGCTGCGTG
CGTGAGGTTTTACTTGCAGTATTGATCAAACCACAGTCGATCTATATTTCTTTTCATACCTCCACTTGCAAACCAAGGTTAGATGCCGTAGCTGTAGACC
CAACGTAGCAAAAAATATCGCTATTCCTAGAAGCAGTTCTCGCACGTTTACCGGTACTGTTAATTGAGAAGGTGGTAGCTGTGCTGCATGTTAGAATTAC
CGAATTCCTGAGAACGCTTTTTTGTTTTTGTGTCTTTCTTGTCAGCTAACTAAACAGGTCAAACAATAACCCTTCGATGGAGATATAAGATACGTAAGTA
TCGGGCGGTGCAGGAGGAATGCAGTACTCGTACTGGCGTTACGTGCCCGCTGATTATCTGCTCATTTGCCATAGTCAACTACCAAACTTCTATTGTGTTT
TGTTAGCCCTACCATTTTTCATGTGCCAGCAGTCCCCGTACTTGAACGTATAGCTCTGACACTCTGGCAATGTGACCCGCTAGATACCTTACTCTATTCG
CGGCGTGATTTATGGTGAAGTACTAATGCGAACTACCAAGCTATCCCAGCCTACGCAGAGCTCTAGTTTATTATTTTTTGCCATTAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGTCAGTATGCAGTGACCTCACTTGCTATGGGCCAGGGCGCAGTGACTCTCACAAAGAAA
TGGGTCAACTCGCAGTTTACCCGTAAACAGCAAATGTGAGTCAGCCCACGCCTCGAACAAACCAAACCAAACCAAACCAAACCAAACCAAATGGTTCGCA
GAATGAGCAAAACCAAGTAACCGTTTGAACCAAGGTTCGTTGCGGCTACTTGGTTCTACGGTGTCGGGCGCCATTTTCAAACTAAAACGTACGGTTCGTC
CGCGCCACGATGGTTTAATTGGTTTCAAGGAACCAGTATACCGAGAGTTTCAGGTTCGAAATCGGTATTCTTTTATGAAACGTTCGAACCAAACCATTTG
GTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGTTCGAGCCTCGAATGGAGGCGTGGGTCGGCCCTTTTGGGTTCGCGT
GTTGCCCTTTTTGGGGCATTACCTACTGTCATCTGTTTACCCAAATGGAGGGCCTCATCTCATGCTAACAATGTTATGTGTTGGCCTAACATGTCCTAGA
CGACAGCAAATCTTTTGACTTCTTCCTGGATGTTGCAAGAAGTAATCGAGGATTAGAGACGCCTTAGAGACGCCTTCGGCACCCCCGTGAT