Description :
From Genome Similarity Track
Location :
Scaffold_25:774826- 777607
Sequence
2781 bases(100 bases per row)
CACAGGCGTCGCCGTGCCGGTAATTACGGTCGAGGCACGTCGCGCCAACGTCTTGCTACCTGGAGACGAGATTGTCGCATGAGCTGGCTGCGCAGCTCGC
TACCAGGGGGCATGGCTAAATGTCGGGGACGTCCCTGCGGAATGGATGGTCCGCGTCTGTTAAAATGAACAGTACACCACTGAGAAAGCTTACTACAGTG
TATTTTTCTTTAATCTCTCTATCCTCTATACTAATGCTTATACAGACTGGAGCTCAGGGTCTGAGGCAAAAGAGGAAGTGAGCTCGTCTTCGGACTGCGT
TCTTGGCGTCTGCACACCTCGTATCGTCATCGCACTATGGTTGGCAGGCGGCTATCTGCCTGCACAATCCAGATCACAGCTGTGATCTGAACTTCCTCTC
GTACTTGCTAATCAGAATTAGAGAGGTTTTCGTTTCAGTTGTTATTTTAATTCTATGCCAGACAGGACTCCCTGTCTGCCTTTTAGCGAGAGGCGCCCTC
ACCGCGCCATTGCCACTCAACAGCGTCCCATTATCCGTGGAAGCTCTGTCGCAGAACATCTGCCAGCCAGCATACGCACGACCTATGTGGCACGCAGACT
GTGTGTGTGCTAGGTGCATTTGGAGTTGTGTTATTACTATTTTGTCCAGCTAGAGCGCGTTTGTGCGCGCAGCCCGCTTGCAGGTTCGTAGCCGTCCCCT
TTGGCGTTTCATTAGACTTTGATGTGTGTTTTCCTTAACGTTACGTCCTGAGGCACACTATACATGGTTAGGATGAGACACAATCGGAGAGGGGAAAACA
ACAACCGGATAGGATAAACTAATTTATAGACCCAGCCGGGCAAAACCACATGTCCCAAATAAAAATAGATCATATGTAATGACTCTGTATTGGAGAGATG
TACATAAACAACGCATTTGGAGTCGACTTTCACACTTCATCTGTTTGCTTCGATTTGTGACCTGCGATGTTCCCACTACCACGCAGTAGTTTGCATCAAT
GGCGAGATCCGAGTTGGTCTACATTTATCAAGTAGACGGAATAATCGAGGTGTAGCTGACTCTTAAAATATACACCGGTGCACGCGTTATCTGAGCGGCT
ATTCGATCCCATAACCTCGCATTGGGGCAAGTTACTGTATCGCGTTACTCTCGTTATCTGCGCAATATTTGCATCCTCTTCGAACTAAAATATTGTGCGA
TCTACTCAAAACCTCAACGCGCGATTCGTTGAATAATCAGCGTAGACATTCACGCAAATTGGCAATAGATGTGGGCTGAGTAATTTCTACTTAACCTTTT
CGCAAGCCTGCTGTCAAACTATACTCTACAAATATAGAACTCTGGTGCATTCTCGCATCCATTTTGAACGCGTTTGAATATTACACTGATGTCCTATTCA
AAAATCCAAAACACGCTTAACCTGGAATAGAGGGACCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN