Description :
From Genome Similarity Track
Location :
Scaffold_94:77465- 80154
Sequence
2689 bases(100 bases per row)
ACGACCCACCCTTGGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTGGTTCCTGAGACCAAATACTGTGCCACACGACAGTGGCCCTTGCC
TGAGAAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAAGCACGAGGCAGAAATGATACGTGAGAGTAACTCTCCACATTCGACACCGACATTTTGT
GTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGTATGCTTATAACAAGCTCAATGCGGCTACGATTCCTGCCCATATTTTCATTCCTCGAAAGGATGTTC
TTCAAAACAATATGGTTGGTTGTACTTTGTATAGTGCACTCTACTTAGTTGATAAATATTATCAACTGCTCATGCGAGCGAGTGATTATCCGATTACAGC
AGTGAGCACTCCTAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCTGGGGCTGTCTAATGCTCTGGCAACATTTAATCTTCTGGTGACGCAACTTTTC
CGCCCACATAAGGATTACGCACAGTACTTTGATGACATTTTTGTCCATACTCGTGCCGAAAAATGTCGGTCAGATGTTGCAAATCACATCAGTCATTTGC
GAGCCGTGCTCGAGTGCATGCGCGCTAATAAATTGTACGCTAACACGTATAAATGCATTTTTGGTGCAGAATATATTCCTTTTCTAGGATTTTTCATTGG
TAAGTGCGGCCTTAGTGGATCTCGCTAAGGTTAAGACTGTAGTGCACTGGCCGATTCCTAAGAATCAAAAAGACTTGCGTAAGTGGCTTGGCCTTGCCCA
TTACTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGTCCATTAACTAATCTCCTTAAGAAGGACACCGATTGGCGCTGGGACAACACCCATGCT
GACGCATTTCGGACAATAAAGGAGAGTCTCCTCCATTCTCTCATTTGGGCTTTGCCAAATCCTGAGTACCCTTTCAGTGTTATCTGCGATGCATTCGACT
TTGCAATATGCAGCGCTCTGATACAAACAGATGCTGCAGGACGCGAGCGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTGCTGGAAAGAACTATCC
AGTTCATGACAAATAGCTACTTGCTATGAAGTATGCGCTCGTCAAAGTCCATCTGCTTGGATCCAAGCCATTCGTAATCTATACGGATCAGACGTCCTTA
TGCACGGCGACACAGTTGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTACAGAATATAACTTCGAGGTCAAGTATAAGCCAGGCAAAC
AAAATGTGTTGGAATATGCCCTCTCTCGCAGAACTGATTATGAGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAGGAGTTAATTCGTGTGGCACA
TCCACAGGATTCTCAGTGTGTGGCATTGTTTTATGCTCGTGGCAGTGACGAGTACAAAGACTCGAACACCTCTTTTTCTACACGTTTGCGTGCCAGCCTA
CATCAATATTACATCGATAGTGGTCTCTTTTGCTATCGACGGATGCAACGATAACTCCTCGCGTTGTCGTGCCTCACAATGAGGATTTAAAGTACCTAAT
CCTCTTCCAGGCCCACGATACTGCCCTCAGTTGGCATTTGGGCCGGGAAAGACTTATGGCTCTGTGAGTCAACACTACTGGTAGCCCAAACACTACAAAT
GGGTGAGCACATTCTTGCGCACATGCGAAACGTGCCAGCGGGTCAAAACTCGGCACATTCGGCTGCTTCACTCGCCAGTTCACCTGTGACCACGGGGTAT
TGGGATCCCATCAGTATATATTTTGTGTTTGGTCTTCCCGAATACTGTGACGGAAATACGGGAATTGTGGTCCTATGTTGACTGTTTGAGTAAGATGGCT
CAATTAGCGGCAGTGCTGGATTCCGTCGATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTCGTCAACACGGGTTGCCGCTGGTAATCATCT
CTGATCGCGATCCTCGCTTTACAAAAAAGTTTGGACTTCTATCTTCAAGGTGCTTGGCACGCGATTTGACATGCTCACGACGGATCATCCGCAGACGGAT
GGTCAAACTGAGCGAGTTAATCGCGTAATCGGCGATGTTCTTCGCAGTGTTTGTGCTGATTCGCCTACGACTTGGAGCTCGCTCCTCCCTGTCATTTAGT
TTGCGTTGAACAACGCTGTTCATGCATCGACCGGCTTTACTCCCTTCTATGTGAATAGCCTCACGAACCCCGCGTTCCGCTCACGTTACCACTACGTGGT
TCTGGGCTTGGTGGGGGAGAGTCTGCTGACAAGCTTGCTGAAATCAGCCCTACCACGATGCAGAAACAAGTAAGCGAGTTCCTCGCGACGCGCTTTAGTG
TCTTACGACATGTGCGTGATGTAATGGCTGATAGCCAAGACGAACAAAATGAACAAGCTGATGCTAAAGGCAGAGGATGTATTGATTCTCACGAAGTTGG
AAACCAAGTCTTATTAAATGCTAAAAACCTACCTTCAAATATATTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGACCGTTTACGGTC
ATAGCGAAAAAAGACCTTGCATATACACTCAATCTCCCGCGCAAGTTGCGCACGCATCCAGTATTTTACGTTGGCTTGCTTAAGCCATA