Description :
From Genome Similarity Track
Location :
scaffold_808:7745- 13454
Transcript NameFunction/comments
Pl_102327mitogen-activated protein kinase, putative
Pl_102328hypothetical protein PHYSODRAFT_466741
Pl_102329conserved hypothetical protein

Sequence
5709 bases(100 bases per row)
CACGCGCCTCTTCGATAGATTTCTCGTGAATTGGCGTCACTGTCTCACTCGCCGACTCCCTCCATCATGACGCGGCAGCCTTCCACGCGTTCTCCGCTCT
CGGCGCCTTCGTCCGCTCGTCTGCACGGTGCGTCGTCACCTGTTCCAGGTCCCGGCAGCAGCGGCGGCTTACGGACGCAGACGCTGTTGGCGCGCCTGTT
CCGGCGGAAGGAGCGGTCTCCACTGCCGCTGCCGCTGCGGGACGACACGGCGCTGTACGGGGAAGAGGAAGAGACCAAGACGCACGTGGACTCGCCCATG
CGCGCGCTGTTGCGCTCGCTCAGTCTGCAGCGCAGTCGAAACAGGGCACAGGTCGTACGTACGCCGCCGTCCACGCCCGTCCAGGTACTGGTAGAAGGCG
TACTTACGGAACTCATGCAGCAGCGCTATTGGCGCTCCAAGCCTTGTTATTTTGTACTGGAACAGACTGTAGAGAGCAGTGCAACCGTGCGGTTCACGTT
GAGACAGTTCAGCTTTCTACCTGAAAACAGGAAACCAGGACGACTTTTGGCTATTGTGACTCTGTCACAGAACGACGTGGTGACAGATATGAGAACTCAT
CGGCAGGTGAAATATGCGCTGGAGCTGCAATTGGCATCGGCCGATCAGCGCACGGAACTGGCAGGTGCAGATGTGGAAGACAGAGAGGAGAGTGGATCAC
AGGTGCTGAGACTAGCGGCGGGGGACGAACGAACCCATGTCAAGTGGATGCAGACTCTCAATTCGTGTATTAGCACACTTATCTCACAGACAGAGACACA
GTATCGACTCGGAGATTCGACATGGAATGCAGTGACGGAACCAGCCAAGATCGTCCCGATGTTTGGGGACGAAGGACGAAGATCCAGTGTCTTGGTCACA
AGGGAACGAGATCATAATGGCAGCTCCGTCAGCTACTCTAGCAGTGAAAGCAATAATAATCATCTTGAAGCGGACTTTCCAGCTGAAGAGATTCGAGCAG
CAAGGCAAGATCTCACAGACGAAGATGAAGAGTCCAAGCCAGTAGTGCAGGCAACAGCACGAGTAGTTCCAGCTGTGACAGATGAAGAGCTATTAGCGCA
CACAGTGGCCAGATACTGCTGCACGCCGAACTATAGGTCAAGTGAGTCATCGAATTCGCAGGACCCAGATGTTGATAATAACGCAGCGGATGGAAAGAGA
GACGACAATCAGGAGGACAATCAGGGCGACGATGATTCCGAAGAGGATTCTGTGGCTGGAGATCTTGCCACACAAAGCTCAGTGGCGCCGTACAAAAGTG
CAGTCTTGGCAGGAAGGGGTGTTTCTGCTTACCAAACTATGGGGCTAGATGACGAGTACACGAAAGCCAGCTCGAGATCATCAATAGAAGCAGGAAGTGG
GCGAGGGCATCTTCCTCGTGCTGCCTTTGGTGCCAATAGCAGCAGCTCCGGTTTATTCCCCATGATGCGGCCACAGACACACTCCTTCAACGCAAATGGA
CAAGTTTTCACTCTCGATACTCGATATCAGCTAGTCAAACCGATTGGAAATGGAGCTTACGGCGCTGTTATTGCTGTCAAAGACGTTGTCAATGGAGACG
AACACCTGGCAGTTAAAAAAATCACGAATATCTTCGAAGACCTGGTCGATGCAAAGCGTATTCTGCGCGAGGTTCGGCTGCTAGGTCACTTCAAGCATAA
GAACATCACGCGACTACTAGATCTGTCGCCTCCTCCTTCTCGCAAGCAGTTTGATGATATGTACATTATCACAGAGCTCATGGAAACTGACCTACACCAG
GTCATCTACTCCATGCAGCCGATGTCAGACGACCACGTCAAGTACTTTTTGTACCAGATGCTATGCGCGCTGCATCACATCCACTCGGCAGGTGTCTTGC
ATCGTGATATGAAGCCCAGCAATATTTTGTTGAATGCAAACTGTGATCTCAAGGTTTGTGACTTTGGTCTCGCTCGTGGAGGAGTCGGCTCATCATCGGG
GGTACATCAGGAGCTACCTCAGCTTGGTGAACTGACCGAATACGTTGTCACGCGATGGTATCGTGCGCCGGAGATTATGTTGAACTGCCTGCATTACACG
ACGGCTATTGACGTATGGGCTGTGGGTTGCATCTTCGCGGAAATGCTTTTGCGTGAGCCACTTTTCCCTGGAAACGACTATTTGCACCAGCTCAAGCTCA
TTATCAAGTTTTTGGGTACCCCAAAACAAGATGACATTAGTTTTGTGAAGAATACGAAGGCTCTACGCTTCCTCACGAAACTTGCAATCTCCAAACCAAA
AAAATGGCGGGACGTTTTCGCCGGTAGTGGTACCGAGGGTGATGTGAACTCGGAGGCTATTGATCTATTGAGCAAGATGCTACTTTTCAACCCGGAGAAG
CGCATTTCGGTCGACGCTGCCTTACGGCATCCATATTTGGCCACATTTTTCGATGAAAACGATCTAGTGGTCTCTAAGCCTTTCGACTTCTCATTTGATC
TACCGGACGAGAAGTTGTCAAAGGATGCTCTCATTAACCTGCTTTGCGAAGACATTGAGCAGTTCCACCCGCCAGTACCAATCTCGGTTGCACCTATGCC
ATTAAGCACTGCTGCCAGTCGCTTCTTCCGAATGGGGATGACAGCATCAGCAAGCTAATAAGCTAGCACGAAAGGTACGCCCACAAGAAGACATTCAAAG
TAAAATAATTCGACAGTACGAAATCGTAGTTTGTTCACGTGACTAAAATGTTCATCGTTACGATCTTAACGCCTTCCTTGGTGTTGCCTAACTGAAGTTT
GGTGCTCGTACAAAATTTCATGTGACAAAGGTATCGGAAGTGGCTTTTCATATTAGTTAGGTGCTATCGCCATCGCCTCTATCATGCGCCAGCATGGGTA
ATTTTGCTAAATCTCTGTCGTGCAGTTGTCCTTGCCACTTAACTAGTTTGAATTTCCCGCTCGTCGGTCTGCTGTACACGGTCAGTTTCGACGGAGGTTT
CAGTGCTTGCTGGAGACTTGTTCTAAGCACGTACGGAGCGATGCCTGTCTTCAATGCACGACAGGCGAGAAGTCCACGCATTCTCTTTGAATTCGAGCTG
TTACATAGCACGCCACTGGATACTTCGCCATCTTGCAAATATTGACGTTCGAAGCATGTTGAGGCCGGAGCAACACATCGAGTTGGGCAAGTCGAAAGGC
ACTTTTCCATTTGCCTTTAACTCTGCACACCCGACTCCAAGAGCACCTCGCCATGAAGTTCTTCGCCCCAATTTCTGCTGCTATCGCTGTGTTCGCAGCT
CAAGTGAATGCCAATGGTGTCTGCTACGATCCGGACCATGCTTCAGCTAGCGGTACCATGACTGCCGAAAGCGTAAAGGCAGACATGGCCACCATCAAAA
GTCAGGGATTCACTACTGTCCGCACGTATATTTCACAGTTCGGCAACACGAATCTGGGTCTGCTCATGTCGAGCTGTAACGTCACTTCAGCTCTAGGTGT
GCCATACCCGCAATCCGACTACATAACACAAATGAAAGCCGCTATCACTGCCGCCAACGCCGGTGGGGTCGCCTACATCTTCGTGGGCAACGAAAACCTT
GCTGGCGCTACCAGAGTACCCGAAGACATGATCACCACCATCAAGAGCATCAAATCGCTTGTTCCGAGCACGGTCAAGGTTGGTACTGTCCAGCGCAACA
CTGAGGTCATCAATTACGCTGGTATCACCGACTGGTCAAAGCTTGTGGGTGTTGTCGATGTGCTGGGCGTGAACGCCCACCCTTATTTCACTCCCGGAAC
TACCGCAGACAAAGCCATTGATGTCCTGAACAATCAGTGGAAGGTCATGGAGGCAAACTTTGGAGACAAGCTAATGCTTACGGAGACGGGATGGCCTTCG
GATGGAACGCTTTCGGGTAACACAGGAAGCCTCGCTGGTACGAAGACATTTTACAGCGATTACAAGTCGTGGTGTAGTTCGAAGAAAGAGTCCTTCTACT
TCCAACTTTTTGACACCCCTTACAAGACCACCGCATACGAGAAATCATTTGGTCTCCTCACATTCGACTCGGTCGCCAAATTCAATCTGGCAGCCGCATC
CGGTGGTGCAGGCACAGTGAATTAATATTCGGGTTGGCGACGGAATTTTGACTACCATCAATCCCTTGTGCACGCTCAACGTTCGTTTATACAGTACTTT
AGCCGTTCTGAAAGACCACCACAGCAACATTCACAATAGTACCCTACGTGCAAGCTTTCGTTGCGTTTCACTTGTGCTTATACATGGCCTCCGGAAGCAA
AACCGCAATCAGTAAGATATTGCTTGGTATCATCACGAATAGCGAAGCCGGAACGCAGATTGCACTGAATGCTGGTATCCAAGGACACGATGTGGTGATA
CCAGTACGACGGAAGGTACAAAACTTCACCAGCAGTGAGTGCCACTTCCGTTGCAGGACAATTGCGGGCGTCCTTCGGTAGAGCACTAGTGTCCGACCAA
TTAAATAAAGTGTGGCGGGCAGATTGACCCTTAGTCAGTAGTCCTTGGCATTTACAGGCACTCGGTGGTGCTATCACGTAGCGCTTAGTTCCACGGACCA
TAGAGATGTGATTGAATCCGCCGTCAATATGACCTTCGACAATAATACCTCTCATTCCGAGACGACAGCGCATGCCACGCTCCTTGGCAACAGATACATC
ACGAACGAAAAAATCACCGAATCGTGGATCGTGTTCGGTCAGCATTGGGTTCAGGAATTGAAGTTCGTCGTAGATAAACGCTGCCTGTTTCAAGAAGTCG
TTCTTCTTGAGCATAAAATAATAATACTCGTGATGTTTACCAGCCTTCTCGAGCGGCTTGGTATTGTTGATAGCTTTCACAAACTGCGGATACGTCATCC
AACGCGATTCGTACGGATCTATCTCGCCAGCGATCTGCTTACTCTTGAGGTAGTACATGAAGTGGCTGTCGTTAGCGACATGGACCTTATACAGTGCCTT
CGGGTTAAGTTTCCCCGTCAAGTACTCGTCTGTCCACCGCTCCGAGGCAGCAGTGAGCTCCGGCACACCGTAAACTACAAACGGCACCTCCATCTCACGA
AACATCTGAGCCAACCGAAACTCATACTACACCACCACCCACAACAACAACAACAACAGCAACAACCATTAGCTGTATCACTACGACATGTCAAACGCTC
GACGCAACTTACCGGATCAGAGACATTAAAGTGGCAAATACTATCGAAGATGGCATGAGGCACTTGAGCCGTATTTTCAGGTTTCCAATTGTCGAACAGA
GCAGCAGACGGAAACAACTGCGGGTAAGCTTTGCACCCCTCGTCTCCGTCCAAGTCGCACTGGTATCGTAGCGACGGGAGGTCACATTGGAATTTATTGG
TAGCTCCATTGGGGTAGTGAAGTGGCAGATATCGCTGCAACTTTTGGCCCTTTAGTATCACCGCATCATTGCCTGTCCCCCATCGTAAAGAGTTGGAGTC
ACCGCTCGCTTGGAATTTCGACCGGAGGTTTTCGAGCGTTGACGTCATTTCGGATGATGGCGAGACCCAAAGTCCCAAACTCAGAACCCCTAGTCCGCAC
AGCAGTAGTAGGGTGAATGCAGCTCCACCGCATTTGCCCTGACGGAATTCCCAAGCGCCGCGACGCAGGAACGCCGTGGTGCGAAGCTGTGCAGCATTTC
CCGACTTGG