Description :
From Genome Similarity Track
Location :
Scaffold_568:7745- 11086
Transcript NameFunction/comments
Phyta_totarag9324hypothetical protein
Phyta_totarag9325hypothetical protein
Phyta_totarag9326hypothetical protein PHYSODRAFT_305166

Sequence
3341 bases(100 bases per row)
GGAAGATCGGTCCGCCTAGTGTGCTTGCTAGCTTCAGGATGCACCATATCGCGTAACGCCATCTGTTTAAAGAGCATCTTCTCGATACTCTTGACAACTC
GTTTTTCCTCTTCCCATTGCTTCTTCAGTTGAGCATTCTCCCGTTCAGCTTTCAACCGTCGACCAAGTTGACGAGCGCAGATCTCTTGCCACACCTCCGG
CAGTCCACTTGCATCATTGTCAGTAGTATGGACTGGTTTTTCAGACGTAGTGGTATCGACTGGATGTCTCTGACGACTGCGAATGGTCTGGAACTGCTTC
AATGTGAGCTCTAAGTCCTCTGCCTCTCTCCGCAGCCGCACAACCTCGAAACGACGTCCATCACGAGCTCTGTTCGaatcgagctgcttcttccgcttTC
TCCTCTTGGGTTTGGTTTGCCGCGTGGCTCCTTGTGTTGAAGTGTCCGTCTGGTCCATTATTGATTGTGTCATCTCCGCCGTAGGAATTGATGGACTGGA
AGGCCCCGACTCAATGCGAAAGTCTCCGCCATCACCGTCGATAGCCGCTAGCAGCTCGTCGGGATCCCATACGTCGTCAGATAACGATGGCCAAGCTGTA
TTATCATCGGCAGGGGCAGTTCCAGACCGCTGTAGCTCCCCATCGAGGAAGGTCAGTGTCTCTTCCAGCGACTCGGAGCTCATTTTCAAAAATGCTGACt
atacagtacatgtacatcggTGGTCGTCCAATGTGTGACATACACAACTTTACGGACCAATCAGCATTCAATAAAAAATACAGAATGGCGTTGGAAGCTC
CAATGGAGTTGGAGGAAGCTTTGGCGTTGTTGGACGAGTCCCTAGGCACTTCGActgagctccagcagcccCCCTTTCCGTCTTTTATTGCCGACTGGGA
GCCAGATTTACACTGGGGGATACTGGATGACGATATCGGAGCATTTGGCAGCGTAGACACGTCCGCCATCACAGTTCAAGCCACTTCTGAGACTGCAACT
GCCAACCAGTTGGCCacaaggaagaagaggaaggaaATCAACCCGAACAAGGCTCGAGATGAACGTCGCTTCCAGTTGATTGAGTTGCAGGACCACGTGG
CAGAGCTGGAGTTCACTTTAAAGCGGCTACAGACCATTAGGAGCGAGAGACCGAAAAGAATTGGTCATGGGAGCGATTCCTCTGATAATAACAATGGGGT
GCCGCCTGTGTGGCAAGAGATTTGTGCTCGTCAGCTTAACAGGAGATTGGAAGCTGAACGGGAGAATATTCGTCTGAAGCAGGAGTTCgaaaaggagaag
cagctaGTCAAGAGTTTTGAGAAGCTGCTCTGCAAACGACGAGCACCGACGGATACAGAGCCTAGGGCGACGAAACACACACGACGTACAGATATCCCTG
ATGGGTACATCGAACGTATGGCTGCGTTGATCTTCAAGGAGCTTGCAGATGGAGTCAAAATGTGTTATCACAAAGTTGAAAGCGTTTTTGAGACCAAACG
CCCTGTTCCCATGAATTTGGTGAGCCACCGCGCTCTTCTCGATGGAGGAATGAAGGGCATGGAGAGGAAGTTCTACGACAGAAGAACCATACCGTTTGAT
ATGCGTGCGACCGGAGACGCGTGGTGGGAAAACTGGCATAATTACCGAGGGCAACGATTTCAAGATGTCGCAGCTAACGAGATCACAGAGAGCTTTGGAT
TGGAGATGAGTGACTTCAAGACCAATACTTCTGCGACTGCGTATGCACAGCAAATCTCGCATCGGCACATAAAAGACGATcgcgtcgtgttcgtgtgGGA
TGCTTACGTTGAACCGTTTGGTTCTGTCAACGAGCGGGTCGCTGGTGTCTATTTTCTAGAGCAAAATTATGTGCTGATTCAACCTGAAGACTGGAGTTCG
GAGCGAGGTTGCTTTACGAGTGTATCGACTTGCTATGTACTCACGCCCCACTTTCTGGACCCGAAGCTAAaagaagacgccaagacGGTTGCGGTGATTA
ATTTTTTGATTAGCGCTCTATCCACAAATGTCATGGCACCGAGTGAAATGGTAGAGACTCTTCTGCTAGACCAAGCGCTACGGCAGTTTAGCGATAGGTA
AACGTTTCCGTTTGATGGCTTTACTGTTTTTCCGAGTGGACGCGTTCTCCAAACGAACTCCCATTTTCCAGTCAGCAAGTAGCATTGCAATGAAAACATG
CTCTTAGCAGCTAGAAATGTTTGTTTGTATACTCTGGGCCATTGCTACAAGTGATGATGTATGACAAAGGACTTGGTGGAAAAGAGCGCGTTGGAATTGA
CTTCGTCTCACTAAAGCTCAACGTCAGAAACTACCTACTACTGCAGCTATACCCGCTttcgccccccccccccccccccccacggCGGAATTCGACAGGA
AACCCGTCTATGAATGATGAACACGTGATATCAATTCTTCGTCAGAGGACGCTAACTGTACCGATGGATATAGTCAAAGTCGTGTCAGCGGAGGCTCCAG
AATTTGGTGAGGGTGTCTCCAGGAGGTGCTAACTTACGTAGAGAAACGCATCGAAGTATGAAGCTCTTGCGGACAATTCAACTGCTCGAGATAAGCCCGA
CTGCTGTATTCCAGATAAAGAGGACAATCAAAAGGGACACTAGCTTCGAGTCAAATGGTTAATGTCTATAATTTGATGTCTGCACATAGCGGAGCGGTCA
CATCGGTTGGTGTCGTGGAATTAAGCGCAGAGCTAGTCGAGTTGTGGATTGCAGCTGACTGAGAGTCTCAGGCACGACGTTCTGATCGCGGACGCAATAG
GCGAGACTTTGCGTGCAGAGTGTTTGCAGCATGAGGCGAGTGCTTTTCACGAGCTCGTTTAAGCTGGCACAGTCACTTTGCAAGAGGACCTCACCGCCAT
TGGACAGTTGGTGTCGGATTCGTCGGAGCACCTCGTCCCGGTATGTTGCATTGgtcaccacctcgtccacaGGCAGATCCAGTAATTGGAGCTCGCCACT
AAACTTGTCCTTGGATGGGTCGGCTGCCTCACTGACTTCGCTTTCATCGTTGTTGGTATCTTCTTGCAGTGTCGCTGGTTGTTGGGCCTTTGCCTTTGCC
TTTGCCATTGGTTCTCGGTCTCGCCATCGCGTCCCCCTTCGAAATTCTAGGATCATCTCTCTCTTTTGAATCGCTTTCGACGTATCGCGCGCCTCTTGTT
TTCGTGCACGGGCACGATAGGAATGTTTCACCTGGCCGACTGTCTTGGGAAGTTTCTCGTCTTGCGGATTGTGGAGATCGTCTTGGCCAGCGACCCAATC
GTCAATGGAGTTTGACGTGCTGCGCCATGTTTCAGTCCCCT