Description :
From Genome Similarity Track
Location :
Scaffold_29:7745- 9433
Transcript NameFunction/comments
Hyaar_Emoy2804449hypothetical protein

Sequence
1688 bases(100 bases per row)
TACGCCGTTCCTCTTGTTTGAGCTCAGTGGCAGCATCCGAAACTGAGAGCGATGATGTGGAAGGGTCAATACCAGACGCTGCTAGCACTCTACGACGTTC
CGCTCGTTTGAGTTCACTCGCAGCATCCGATACTGAGAGCGATGATGTGGAAGAATTGATAGCTGAGCTTGAACGAGGTCCAGCTGTGAACCATGCAGCG
AACACAGAGAAGCCCAAGGCACGAGTAAGAGTGACTCGGAAGCAGTCAAGTCGTGTGCAGGGAGTGAAGCCAAAGCAAAGCCGAGCCAAAAAAGAACCAA
AGACAGTTCGCGCTCCCCGTGTCACTCGACAAGCAGCTCCACGAAAGTTAGTTGCACCGCTTTCTGCTCGTGAGCCTCCAGCTGCACCAAGAAATGTGCC
CAGCTCTCGACGGTCCACTCGATCCAGTTCAGTAGCCTTTGACAGCGGAAGTGATGATTTGGCAGATCTGGAGACTGAGTTGCAAGCTGCGTATACTCAA
CGCTAGAATTGGCACGAACAGTTTGTGGCGATGGTCCTGCGCTCCAGGTCTTCTGTAATGTAGGGGAATGCCGAAGAAGGAGAGAGAGCCTCGAAGGAAG
CAAGCGATGTTGCGGACGAGGAAAAGTATGATTTTGCTTGAGGTGTGATTCTGGATGCATTGGAAATCAGAGACGTGGCCAGTACAGTCGAAATCTGCGG
TTCCATGACAGTGGGGCTCATTCAACCGCGTCGTTTCGTTCATAAGCATGTATTTCTACTAGTGTCCATCACAGCCCTTCCAGCACCACCACACGGCTGC
TTTGCTGCCTTTATGATCCGAGCACGAGCAGCAATGTCTGACAGGAAATGGGATATTATCTCATCTGTTCATTGTGTAACTTGCACGTAGCTGATGGATG
AACGAACTGCAAACGAGCAATGCAGCTTTGCATGTAGTGACCAAACTTCAAGCAGACTGTTCACAAGTGTCTGCGGCTCATTCCGTTACCGACACCACCA
CCCAACGGCGCATATCGACTAATGCAAGCTTCAATATCAAGTGTTGATGACGAGAATGGAAAATCTCTGACCTGGGTGTTTAGCGAGACGAAGCAGCGGC
AGTAAGTGCAGCACATCGAAGCTACTATTACGTGACAGTCAAGTGGGGGTGGCGCATGACCGCGAGTCTTGTCCACAGAATACGCTGGTTGAAGAAAACT
GCGGCTTCAACACAATGTACAGGGATGTGCCTCCTCGCTTGCACAACGCCGCGTGCGAAGAAGAGCAGAGCCTTCATGTGGCTATTATTTTCAGACGAAT
GCACCGGCAGCTACGAGCACGCTCCGTTCACACACGATAAGCATTTTGTACTCATCGGTCTTCTTCTTCGCTGACCTTCTACTTGCTCTTGTCCTCGATG
TCAGTACCGTGTGCGTCGCTGCTCGCTTCTATAAAGTGCGGTGAGAAGCACAGAAGCCCAGCACTAAACGCAGCAAGACATGCTGCACCGTATGCTGGTC
CATCGATCGAAGTAACGTACGTCCATCCTGATAGAACTAGAGCGCGCTTGTAGCAAGTCACATTCGTGAGACATGGGAAAACGTGTAGCAAATAAGAGGA
GACGAGACGAACTCATTTGACACTTACTTGGTCCGAAGGTTCTAGATACGGACTACATGATCGTCCAGAAATAGCACAACGATCAGCA