Description :
From Genome Similarity Track
Location :
contig_87:77435- 79167
Transcript NameFunction/comments
g10506.t1abc transporter

Sequence
1732 bases(100 bases per row)
ACTATCTCGCTTAACGGCGTCCCGTGTGGAACTTCCACAGGATGAAGGCAAAGATGGCCTGGAACGCAACAATATACACGACCAACAACAGCATGTCGCG
AGGAACGTCCACGTCCTCCATGCCGTACTTGGCCAGAATGGCCTTCGCAGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAACGACTCGAACGAG
TACGAGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCCGGGATGGAGGCGCGAGGCACCATGAAGCCCTCGCACAGCATGAACATGCCGAACACGC
CCGCCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCGATCACGTGCATCATGGACTCGGACACGACGAGCGACAGGAAGAGGTTGAGCAGGA
AGTACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAGCGCCGTCGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAGGAAGTTGGCGCA
CACGTAGCTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGCGAACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACCGACATGAACACC
AGGAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCCGTCAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGAAGCTCAGGCAGA
AGTACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGTTGTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCAGAGACGAGGGCGA
CGGCTGCTCGATGTCCGGCAGGTGCTGCAGCGTCTTGCGGTCGCTCTCGATGCGCGTGCTCAGCTCCTTGCGGGTCTCGCTCTGGCGTAGGCCTGCACGA
GCTTGGGCACGTCCGCGTGGTCGTCGAAGTCCGTGTTCACGAGGCTGATGAAGTACTCGGCCGGGTTCATGTAGTTAGGACAATCGTAGCCGGACGACGC
AAAGTGCGGGATCATCTTGGCTCGAGGGCCGCAGTAGACGGTCTGGCCGGCCGACAGCACCACGACGTTGGTGAACATGTCGTAGACCAGCGACGAAGGC
TGGTGGATGGTGCACACGACGGTTTTGCCCTCGGCGCAGAGCTTGACGATGAACTTCATGACGTTGTGCGTGGCGCTCGAGTCCAGGCCGCTCGTGGGCT
CATCCAGGATGAGGATGCTCGGGTTCGACAGCAGCTCGATGGCGATGCTAAGACGGCGCTTCTGGCCGCCCGAGAGGCCCTTGCGGAAGATGTCGCCCAC
GAGTGTGTGGCGGCACGTGGCCAGCCCCATGGCCTCCACCACGTCGTCCACGCGGGCCTCGATCTGCCTCGTCGAGACGCTCGTGGGCAGACTGAGCTTG
GCGGCCATGCGCATGGTCTCGAGCACCGTGAAGGACCCGAGCAGCGAGTCCTCCTGGGCCACGTAGCTCGTCACGGCGCGGAACGTCTTGGTCACGCGGG
CCTCACCATTGAGTTCGATGTCGCCCGTCACTTCTCCGGAGCTGATGCGGTCGGCCAGCAGGTCCACGAGTGTGGTCTTGCCCGATCCGGACGGGCCCAT
GATGGCCGTGAGTTCTCCAGGCGCGCAGCGGCCGCGGACGTTGTCCAGGATGACCTTCTTGCCTGCAGGCGCGTCGGCCGTCGAGCGACAGGCGACAGAG
TAGCTGAGGTTGTTCCAGCTGAGCACGCACGG