Description :
From Genome Similarity Track
Location :
Scaffold_253:7743- 10711
Transcript NameFunction/comments
Hyaar_Emoy2813207hypothetical protein

Sequence
2968 bases(100 bases per row)
AGTTCAAGGGGATGGTGAAGTCAGCCTTGCGGCCCTTCCATTGCTAACTGCTCTGTTAGAGTTAGTCAAAATGTCTGTAGATGAGTTCAGTCAAGCCTTG
AAGGCAGACACTTATCCGATATGGTGGTCCTTAGACCCGATAATTAGTTGAACTCCTCGTCTCTCTTGGATGAGACGGTCCTTGAGCGTACAAAATCGGC
ACTTAGTGCACGTATTGGATCATCCATTTTTAAAAGACCTTCAGATCCCTACTACCCTTTGGTTAAGGAATTTTAAGAAGTGGTATGTCATGATTCACCG
TCTGTATTACCTCCCGATAGGGGCGTACGTCATAAAATTGACTTGGTTCCTGGAACAAATACTGCGTTACACGGTAGTGGCATTTGCCAAAGGAACAATG
TGAAGTCATTGAAGAGTTTTTCACTGCTAAGCACGCGGTGGGGACGGTACGTCAGAGCAAGTCTCCTCATTCCACACCGACATTTTGTGTCAAAAAGCCC
AATGGTAAGTGGTTTATTGTACATGCTTATAATAGGATGAATGCGGCCACTATACCGGCACAAACACCAATTCCTAGAAATGATGTTCTTCAGAACAACA
TAGCAGGATGTACTATGTACAGTGCACTCGACCTGGTTGAAGTATAGTATCAAATGCTCATGCGAGCAAGCGATATCCCGCTCACAGTGGTTAGTGCTCC
AATAGTTATGATTTGGGAGTGGCTGGTTATGCCCCAGGGCCTTTCCAATGCCCCGGCTGCATTTAATCGTCTGGTGACGCAACTTTATGCACAAAAACGT
GTTTTTATGACATAGTTGGTTATAGCCGAGCGGAACAGGGTCGATCGGACGTGGATAAATACATCGACCATTTACGAGCTGTGCTCGAGTGCATGCGCAC
CAACGAGCTGTACGCTTATGCATCAAAATACATCTCTGGTGCCAACCAGATCCCAATTTTAGAATGCTTTATTGAGAATTAAAGTCCTCGGGCGGATCCC
GCAAAGTTGAAGGCCATACTGGATTGGCCAGTCCCAAATAACCAACAGGATTGCGCAAGTGGCTTGGCATTTCTAATTACTTGCACAAGTATAGCGATAA
CTACGCGGATATGACTTGGCCATTGTCCAATCTCCTTAAAAAGGATGTGGGGTGGTGCTGGACTAGCACCACAAAGGATGCTTTTAATGCCATAAAGGAG
ATTCTCCTACATGCCCCGACTGTGGCTTCGCCAGATCTGGTCGGCCTTTCAGTGTCGTCTGTGACGCTTCTGATTTTTCCATTGGCTGCGCTCTGTTTCA
ACAGATGTTGAGAGACGCGAGCATTTCATCGCTTATGAATCCCGTAAGCTTAAACATGCTGTAAAGAACTATCTAGTTCACGACAAGGAGCTACTTGCTA
TGGAGTGTGCCCTAGTCAAATTCAAATTTCATCTGGCTCCAAGCCTTTTGTAGTCTAAACAGATAATGCGTCTTTACGCATGGCGACCCAATCGCCTCAC
CTCTCGCAGAGGATGACCCATTGGCTTTCATTCTTTGCAGAATATAACCTCGAGGTGAAGTATAAGCCGGAGAGGCAAAATACTCTGGCTGATGCGTTTC
ACGCCGGTCTAACTATGAGCTTGCTCATATTACGATTTTGTCGTCGTCAATTACTAACTTAACCCGTGCATCTTATGCAAAGGATGACCAATGTTTAGCT
TTGCTACCAGCTCTTATAAGCGATGAGTTCAAGGAATCAGACATTAAATTGTCGGCACGTTTTCGTGCGAGGCTACATCAATATTCTATCGGTAATGGCC
TGTTGTGCTATCGCACGGTTGTTGCAGATACCCCGCGTATCGTTGTTCCTCATGATGAAGAACTGAAGTATTAAATTCTCTGTGAGGTCCACGACACAGC
GATTAGCGATCATCTCGGTCGTGAGAAGACCTACGTCTTAGTCAGCCAGAGTTATTGGGGCCCAAACTCTATATATGAGTAAGCACTTATGTGCGCACAT
GTGAGACGTCCCACCAGGTCACACCCCGGGAGCATGCGGCTACGCCGCTGGCTAGTCTTCCTGTACACTCTGGGTGTTAAGAGTCCATCGGCATGGACTT
TGTTTTTGGCCTACTGAAGGATTCGGGCGGCAACACAGATATTGTGGTCTCTGTTGACCGTTTGAGCAAAATGTCTCAATAAGCGGCTGTGCCGGACCCC
ATTGATGATGAAGGTACGTACAGCTTTGCTGCTCGTTGATCGCGTGTTTCGACAACGCGGTCTGCCACTAGCAATTGTCTCTGACAGAGACCCTCGTTTA
TCAGGTAAATTTTGGAAGTCCATCTTTAAGGTGCTCGGCGCCAAATTAGACATATCTACAGCGGCTCACCCGCAGACCGATGGTCGGACTGAGCGCTTTA
ATTGCGTCCTGGAAGATGTCGTACGCAGCATGTCTGTTGATACGCCTCGGCCTTGGAGCTCAATGCTCCCCATCGTTGCTTTCACCATGAACAATGCTGT
CCATGCCTCGACAGGCTATACTACGTTCTATGTGAACGGCCTCACACAATCCGCGTTCCATTGACGCTACTAATACGTAGTTCAGGGCTTAGGGGGGAGA
GGTGTCCGATGGGCTTACTGATGTCATCCCTGCTACTGTTCAAAAACAGGTTAGCGCGTTCCTAACAACGCGATTGAATGTCTTACGACATGTGCGTGAC
GCAATGGTTGATAGAAAAATCAAACAGAAGGAGCAAGAGGATGCTAAAGGAAGGTGTTTAGAAAGTTATGAGTTCGGTGACCGAGTCTTACCAAGCGCTA
AGAATCTAACTACAAATGTAGTGTCAGCTGCGTTTAAGACGAAGCTGCGTCCTCGCTTCATAGGATTATGTAAGGTCGTGACCAAGAAGGTCCTTGCTTA
TACGCTCAACTTACCATGAAAATTGCGTACACACCCTGTGTTTTACGTTGGCCTCCTTAAGCCGTATC