Description :
From Genome Similarity Track
Location :
Scaffold_1167:7741- 10337
Sequence
2596 bases(100 bases per row)
ACAAGTGTAACGGATATTACAATATTGCAGGCAAAATCGAATTGCAGAGAGTACATGAATCTTTTCGAACAAGAGATTtggcttcatcttcaacggATTC
GTCAGCCCTATAACATTAAAAATCTAGATGTCTATGCAATGCACAAGGTATTTTCACCTCGTTTGTCTCCCATCCGTACTCGGTTTCATTAGGGTATACA
ATGTACGCAGACTAACGGGGGCACTTTTGCGCGGAAGGCTTGGACTTGATGTGATGCTTGGAATCTGTTTTGGAATGTGAGCTTCATTAAAACGAGCGAT
TTCCGCTCCACTACGCTAGGTGGTTTACTCCGCAAAATATGCGCGGAGGATCCTTTGGGCACTAGGACGCTTAGCAAGCACTCTGTCAACTGCAACTACC
GTCACTCGCCTATCCTATTAGGCTGACTAACACCTTCACTACGTCATAGGCAACGGAAGGTCGGTACTTACACCCATGTGTTCAGCATGTATTCAGTACG
CGTCCAGTGGCTGTCACCGGAGACCGAACATCATCACTCCCCCTCAACTTAATGAGGGGACCACACCGCTTGCAGTGACCGGCTTCCCGAACTGTGGCGT
GAAGTGCGTCTTGGTTAGGTAGTCTGCAAGTTGCTCGGTGGACGCGACGTGCTCCACGTTGATAAGGCCTGCGTCCACGTGGTCACGGATGAAGTgtttg
ttttgttttgcagtgaggtacattgatgtcacttaacTCTATTCACTAACGACTTCCAACGTCCGTCCCTCAGGTTGTCTCCACACCAACCGTCGCCTCT
GCGTTAGCTGGGGCCTAATGGGGATGAAGTGTAGACGTAGATCAATGTGATTCGCTCTAACGCTGTACCCGCGATTGCATGCAATGCTAATCGCTGCCTG
GTTGTCCGCCATGACATGCACTGGTGAAACCTCATGAGCCCCGATTTCGTCGATCAGCTAACGCAGCCACTCTGGCTCCTGCGTTGCTAGTGCAAGAGCC
ATATACCCGGCTTCGGCTGTTGATAGTGCCACCAATGCTTGGGGTTTGCTTTTGAACACTACCGGTGCTCCATCCATCAACACCAGCACGCCTGACGTTG
AGCGACGTGTAGCCAATTGAGTTACTGTAGCCGACAATCGTAATGTCCTTATTGTGTGCACCCCGCTTAAATACCAGCGCCATGGACTCGATGCTCTTCA
GATAACGAAGCACCCGAATGGCAGCACGCCAGTGCATTTCCTGAGCCTTGTCCAGGTATTGCGATAGCGCACTGTGCGATACGCAGATATCAGGGTGAGA
GCCGTTTGCCGCATACAATAGCTACCCGATCAATTGTCGATATGGTTTTTCCGGCGGGAGCGGAAGGAGTCCATCCGCAGGGCGATGGTCTTGGCCGACG
ACGTTAGGGTTTCGAACAGCAAATACATTAGTCTGTCCTAACCGTTCGACCACGCGAGAAATAAACTGCAACTGGTGCAAACGCAGCTCCCCTGAACGCG
GTCGTAAAGCACCTCCATACCCAGCACGTAACGTGCATCGCCAAGCGACTTCATCTTGAAGTGCTTTGGCAAGTCTCGTTCAATCTTAGCAGCCTCGGAT
TCAGCTGCGCACCCAATTAGCATGCCATCGACGTAAAGCACCACAAACACAGGACCATACTGTCAAACTCGGACAAATAGACAGGCATCACCTCGACACT
GCTTGGACCCCATTCATACGAAGACACACGAATAATTCGAAACCATACTGCTGCCGGCTGCTTCAATCCGTACAGGCTACGACGTAGCCTCCATAGCATC
CCCTTGTATGAACAAATACCAGCGAAATTGTCATGAAAACAATATCATCCAAATCTTCATTGAGGAACGCCGTGTCCCCGTCGAATTGCTTCATGTAGTA
TCCTAGGTGATTGCAGACAGCAAAGAAGACACGCAAAGTAGACAAGCTAGCAACAGGCCAGTAGGTCTCATGGTAGTCTTTTCCATACGACTACAGGAAA
CCTTGAGCGACCAAACGAGTTTTTTACCGCACAATCTCACCGTGCTTGTTCCGTTCGTACCCGAACACACACTTGCAACCAATCACATTTACACCAGGAG
GGCGATGCACAATATCCCAGGTATGGCTCTGAAAATTTGAGCGTAGTTCAGCGCGGATGACCTCCTTCCGTTTCAACGCTTCCTCAGACTCCATGGCCCC
ACGAAAGGTAACCGGAACATCTTCAGCAGCCAGAGCAACTTCATCACCACCATTTACACGAGGTTGCTTTGGGTTTGGCTCAGCTCCATAGTCACTAGAG
GTGTCACTACCCGGTGCATCAGTCGACGGAATATCAAGTGACTGAGCATGGGCAATCCAAGTTGCACATCCGACACATTGTGGCTAGATAGTGGCAGGGC
AAGTGGCTGGCTGACAGGCAGAACCACACTCGGAAAGAATCGCGGCACCATCTCGTGCCCAACAACCGGGCGTCGGGCTGAGCCTTGGAACACCAGTTGA
CTCTCCCCTCATCCGAGTGTCCTTGCACCATTGCGCCACCCATTGCATGCGTCTCTACAAAGCGCAAAGGCACTGTCGCGAGCTCGCGCGTCGAAA