Description :
From Genome Similarity Track
Location :
Scaffold_2255:774- 2556
Sequence
1782 bases(100 bases per row)
AAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGTCTAAAACGTCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAA
GCATCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGATGATTGTATC
CCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACC
CGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGAATGCTGGCTTCTGCCAGC
GACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCAACTTCCCACAGCTGAAGCAGCGGAT
GTCACGCTGTTCGGCGGACCCGAGTTCCATGGGACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCG
TACGCGCCTGGCGATGGCTGTATTCTTCCTGAAGAGCCACTTGAATCGCCTCTTCAAGAGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCC
CACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCTTGTATCTCTTGCACATACTCG
TGCAGTTCGCGTCTCCCTCGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCT
GAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGTGTACAACCAACTCTTAGCACGCCCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAG
TTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGGAGCTCTACTTCCCCGGACCCAGAAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACC
TTCAGCCGTATTGGCTTCGGGTTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCG
AATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGA
ACTGAGTGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGAAGAGGTTCAGGTACTGTAGTCTACCCGCGGTGGCGTGGATTGACT
ACGAGTGCTACCAGGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTACCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGT
CCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATAA
GTTACCTATAGAAATGCAATGTCGTTTGACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCAGGAGTACTTCTCCGGCCCGTTTCA
AAATGATGATTGGGGTTTTTTATTGATCGCACATAACTGAATAATCTACTTCAATTGGATAAAAAAGACCTTGGTTTTGCAT