Description :
From Genome Similarity Track
Location :
Scaffold_15:77397- 78813
Transcript NameFunction/comments
Phyta_totarag965hypothetical protein PHYSODRAFT_495212

Sequence
1416 bases(100 bases per row)
AGCATGCGGTACATTTCGGTCGCAACCTCGTTCACCTCACTGTGAATCAACATCTTTTTCACCTTCgaaggacgaggaaggcCCTTCTGCACAGCGGTGG
AGCGCCGCTTGAGTTCACGCTCTCGATCCAGCtcacgctgttgctgctcgcgagcttcttgctctccagCATCCTCCTCCCGAAACGCAGTGGAGCGATC
ATCACCAGATTCCTCTTTCTCTGGAACGTTGATCTCGTATTCATTCTGCGGCGCGGGCAAACTATCGAAACCTTGACGAAGGCTGGTGGCTAACCGCTTC
GCCCGAGCCTTTTCTGCCCTGGCATTCTCGGCCTCTGTACCATAAAGCTGCTCTGGGTTGATGCCCAGCTCGTCACGCAGAGGCGTACGCGTGGCAGACA
TCGGCGTCTTGTCACTCACCGCACTAGCCACAGCCGATGAGGGTGTTCGTGATGGGGTAGCCCCCGCATAACCCGTTCCCTCGTAGAGATCGACATTCTC
GCCACCTAGCAGAGGGGTAGCACTGTTCCGCATAGCAAGCAGGTTCGCCGTTTCCTGCATAATGTTGTCGTGCACATCGCGATTAGATGGCGTAGTTGTC
GCACCTCCTCCAGTGGCGGAGCGCAAGGGGGTAGCACTGTAGTCACTCATGAGGGTACGCGTCTCGGAGGCCGACCCATTCTCAAgagcgagcgctgctg
catgggTGGCATGCATCCCCAGCTTGGCCAGATCGCTCAATTCGTCGTTGGAAACCACAGGAGcaggcagctccagcggGGTGCGTTTAATCGCATTGAT
AGggtcgttcttctcgttcaccGCAGCGATGACCTGGGGCAGGTTGGACTTCATGAGCGATTTCTGTCTCTTGGCATCCTGTTTGCGCTCCTTTTTCTCT
TGAGCATCACGGCGCACACcctccagcttgtccagttgcagcgctgcacgCTTCGGGTCAATTCGTTTGCTGGAAATGCGTTTCTCCTCCGTAATATCAT
AAAAGCCCGCCGGAGCTTTCTTCTCGAACGGGATCTCACTCGCATAGTCGATATATTTGCGTTTTTTCATGTGCACTTTCGGGTTGGACGACATGATTCC
GGCCGCCTTTAGCTCCCGTTTTTTCTGCAATGATGCGAGTCGCCGAGCCTCCTCCAACTGCTTCTCACGggccttgcgcttggccttcttgcccttggtA
TTGGCCAGACGAGCTCTGGCCTCGGAcagcatctccttctcgtcttcgtccatgTCCACCGGGTCGGGTCGCGCCGGCTTGTTCTCCGGGTTCGGGTCGA
TCTCTCCAGGTCGCAGCCGTCTCGGGTCGTCGCTCACCTCGAcgccctccttctgctgcgccgcgtccagcagccgcTCGTAGTGCTCCATGCACTGCGC
GGCCGTGCGGCCCACG