Description :
From Genome Similarity Track
Location :
Scaffold_15:77386- 78746
Transcript NameFunction/comments
Albla_Nc14019280conserved hypothetical protein
Albla_Nc14019290premRNAsplicing factor cwc2 putative

Sequence
1360 bases(100 bases per row)
AGCTACATGCAACCATCAGTGCTGTCCAGCCGTCTTCAGAAGTTTTAGCGTTCAAGTCATCTTTCACTGCTTCCCATAAGGCATCGTAATCTGCATTTTC
CTCAAGCGAGAATGTTTTCGTGATTGCCTCCGCTGGGCCAAGCTCCTTTAGTGACACTTTTTCAGTCGAGGAAGCTGCGGTTCTATCATCTAAAGCCTCC
TTTGCTTGCTGCGGTGTCTCCCCTTGAAGTAACTCATTCCAAAAACGAATATTTGCGCTCCTGAAAATGTATTTTTTTACCAGCGGATTGTCATATAAAT
TCATTGGAGCCATTAACGACTGAATTACGACAACTTGATTGACACCAAATTTGAAATGAATGACCGATGAAATGAGAGCACCGATACAGGTTTGCTTCAA
GAAATCATTCACTTTGGCATTCTCGTGTTCAAAATAAGTCGTTTCGTTCATTTGATCGTAATTTGGCGTTGCATCTAATGGCGACGTCGCTCCAGGTACA
AAAATACTTTGTCTGTCGTTCTTTACTTTAATGAGATGGCGTATATACAATCCAAGAAGTAAGGATATAATCTGGACGGAAAAGAAGGCGATACGTGCAG
AGTTGAGAATAAGCATATTTTCGAAATCGATTTTCCCCATCAGATAGATCATGGGAAGCATCATAAAGATCCGCATTGGACTCTGTTTGCCTGTCATTTT
AATTCGTGAGGGAGCAGAGAATGTCTTAGCCAATCAGTTTTCAGAATTAATAACCTGTGATCACCTCATAGAAAGTGAGTTTTGATAATTAAGAGACTCT
GGAAGCCAAATGGCGGAACAAAATGCGATCAATAATTTACCTCGCAAAATCACAGCTGTAGCGACGCTGGGAGACGTTGGAGCAGCGTATGCTATCTATG
AGAAAAATTGGATATGTGAGGACTGTCGACATGAGAATTATCCTCGCCGTGAACGATGTTTTCGCTGTCGTGCACCAAAAAAAGCAGCAAAAGATGCCCT
GATAAGCACAAGTACTGGGGATAAGCATAAATGGAGGGAAGCATTAGACGTTGCCACAAATAAGATTTATTACTACAATATCGATACCAATAAGACGCAA
TGGGAACGCCCGGCAGAAATGGGAGCAGCGCCACATTGTACGTAATGGATCATTTCTATTGGATTTGCAGGTACTTAGAATCTATTTTGTAGCAACAGGA
TGGTTTGGACGAGGTAAAGCTGGAACTGAGAATGCCAATAAGTATGCAGAGCTGAACAAGAAATACTTGAGTCGACCAGCGCGGAAACAAATCAATGAAC
TGCCTGCAAAAAACTCGCAACTGGAAGGTGCTTTGGAATATAATATCTGGTATGATAAAT