Description :
From Genome Similarity Track
Location :
Scaffold_238:7738- 14859
Sequence
7121 bases(100 bases per row)
CTAGAAGAGTGCAGCCCGCCCTACCGACGGGTACACAAAGTGAGGAAGGAACAAGCGCAAGCAGAACCAGAGCACCCCCTCCGTTAGTCGGTTATCTGGG
CGCCAGTGGATAGTTGGGATCGCCTCATAAAATGAGCGAACCCCACTTCACCACAATGGTGCGAATGCCCGGATCTTCTGGTGACTCGGGATTTCACTGT
GAGTCCCGTGAGGAAGATGTTAAGATCAAGACAGATTATGAAATTGAAGCTTCAGCGGAAGAGAGATTGCCACGGACGTGTGGAGAAAAAGGATTTACAG
ATTGTCAGAGTTTTGGGAGGGGCTTTGATGACAACAAAAATGAAAGAGGAAGATCTATCTGTAGATCTAGAAGATAAACCAGGACCCCCTCCTGAGATCC
ATTCGTGGACCACCGCAGATCCCTCTGAAAAGAGCGATCTGCTGGATGAAAGTCCAACGGCGAAAGCCAAAACGGCGAAAGCCAAACCCTATGCCTTCGT
CGATACATCACCAGATGTCAAGACGAAGAAGACGACAAAGAATTCTGACGGATTGGCGCGACAGGAGATACGAGCTCCGGGATCGGATCACCCCGATCGC
GTGAAGAGATCGGCCATCTGGCCAATCAAGTTTGTGGAAGATGAGGGGAAGATGGAAGGATGGAAGCTGGAACAGATGGCGGAGATGTATCACTGGAGGA
CTATCAAGTAGTACTTGTCAAAAGATCCATTGCTCAAGATACTGAAGTTTAAGATGTTGGAACAATTCAAGGCCCTATATCAACCCCAGTTGTCGCGTCG
AACGCACTGGATGGAATTGATGGGATTATACAGCTGCTGAACGAAGCGGTACTTGTCGCTTCAACATTCGACGCAAGAGAGCTGTTGGATTGTGAACAGG
ATCGCGTGATACACACGTGTCAATCGCTGTATGAGAACTTAGCCCCTTTGACGGGCATACGTAAAGCTGACGGTCACGCGGAAGCGACTGTGGTGAACGA
TCACGTGAGATTGACGGATGAAGAATTTCAGAGAGGATATCACAATGAATCGTCCTAGTATGCCTCAGTCGAGTCTGAAGTAGAGTCAGGGGACTCAATC
TGAATTCAGCGGGTGTCTTTAGGCCCAAGTGGAGCTGCTCATCTGCGCGATCGCATGGAAAAGAAGGCTGATCTTCGTGATCGCAGGGAAGGGATCGAAA
GCGCGATCGAAACCCGTACGCGTTATAGAAGATGCGGGTTAGACTACCCAAGGACAACTACAATCATATTTTGATGCTGCCATGGAACGATTTAAGCAGG
AACACCGTAATCAGGCCCGCCAAGCAATCTACTCAAGTCAGAGGATCACGGGTGCAAGGAATCTCGAGTCTTGTACCCCTGATGTCGATATGGAGTCTGT
CGGATCTCATCACGGTCGCGCTGAAATGCAATTTCGTGAAGCAGGAGATACCGACAACTCAGGGCAAGCCGAATAGAGACGACCACTTGTGGCTACTGCA
GAGACAGTGCCAGATGGTAGGATTAGCGCTACGCGTATTCGGATTTCTGCAATCGTAGAACTGAAAGAGTTCAATGGGAAGAACAAAGAGGAGGGTCGAG
CCAGGAGATGGATTGGCAAGATCAAGTCTGCCTTCGTACGTGATCAAGCCCCAGATGTGGAGAAGTGCTTGATATTTGGAGATCTGCTTACGGGTCCGGC
GAGAAATTAACACAGTCAGCTGAGCCGATCCACTAGCCATACGTGGAAGGACCTGTTGGAAAACTTTCTCGTGCAATATGGTGGTAATGGGTTTGTCCGT
TGGGAGACAATATTACCTTGCCAAGAAGCGACCAGAGGAGTCGCCTCCGAATTACCCGTATCGTTTGAATGTGTCAGCGAATCGAGAAAAGATATGAATT
TGAGATGGATCCCCAGACATTCGTCGTGAAAATGTTGAATACTTTATTGGGGCCCTGGACGATCGCAATCTGGCCAAGAAAATGACGCTGTTACGTATCG
GGGATGTGGATGATATAGAGTAGACCCTATGTGCTTACCAGCGTATGGAAGATCGACAAACTCAATCACTCATGGGATCGAATAAATTTCGACCACGATC
CGCACCCACAGCTTCTCCAACACCGGCTTAACCAGCGCGTGCCATGAGGCCCATTCATGTGGAGGATGCGGACAGTTCTTCGGACTCCGACCTTAGTGTA
TCGGACGCTGTACGTGAACTACGTAATGTATTTGTGGCCGCGACCTTGGATCGCCCGACGAAATTCGTAGATCAACGTGGTACAACCGACGAGAATCGTC
AAGATTATAGTCCGGAACGCGTCGCGTTTAAGAAAGCCTGCACTCATTGTGGATCGGAGAGACACGACGATAGTGGATGCTGGCAGAGACTGACGTGCCA
GAAATGCGGTCGTAAGGGACATCCATTGGACAAGTGTTTCTATGTGTGTGCAGCTTGTGGAGAGATACATGAGAATGCCAAGTGCCCCATGGAGGATTTC
TATAACTTGATCCGCAAGTGGTACGTGCCTACCAAACATGCTGGGATGTTTCCTCCGAAGGTCGAGGAGATGTTAAACTAGGACGCTCGCCAGGTTGGAA
TCTGGCACGAGCTGAGCGTTCTAGGCTATGCATATATGCATTTGTTGAAAAACAGTTGGAGGATCAGGGAGTTAAGGTTCGGCGCGATCAGATCACTAAT
ATATGTGATCGTTCTACATTAGTTTCTTCTATATCAAGTGTGAAACGAGTGGACGATTATGCCCGATCCCCGGTGAAGATGAAGCTCAATATCGCCCCAG
GGGATTCAAGAGAATACTGTAAATATCATACCCCAGGGAAATTATTCGAAAAAGCGAAAGCAATGGGAAAGATTAACAATGAGAAGGCCACTCTGCTGTT
TGACTCTGGTGCGGAAATCTTGATCTCCGACACAACCTTTTCTCGTAAGGTAGGATGTTTTATCGACGAGAGCCGAACGCAAGAATGTGTTGGGTCGGGA
AGTGCTTACATGGCGGTGGGGCGGACCAAGATCAAAATCACACTTGACGGATCACTAGTATACATTTTGATGTCTGGGTTGGAGATTAAGTTGGTCAAGA
AGCATACTAGGTATGGTCTTCATGGTTCCGGCAGGCATCTGTTTGGATTTAGCCGACGGAACCTTGTGTCTACCAGACAAAGTTCGCGTCTGTTTGGCTG
GGAGGATACCGCCATACTGGTCAAATATATCGTCAATCAAGCTTAACGATCAACATATTGTCATCCCGGCCGGTAGATCGACCGAAGTCAGGATCGGCGT
CAATCCCTTTTTAAGTCCAAACTATGGGTGGGGCGAGATGTGGAGTGGGTTCCTACGGTGACGAATGGGCCCGGAATGATCAAATTCTTGCAGCTTACGA
ATATAGGTGATCGCGACTTGAACGTAAATTACGGGGCATCTTTAGTGTTGTGGATGACAGAAGACATTATACCGCGATCTCGGGGATATGTATCCGTCGG
ATCGCGGCGGTATAAGGAAAGGCAAACATCGGCCTTTGAAGCTACTACAGATCGAGAGAAAGAAGAGATGGAAGTATATGCGGGACCGCTAGTGGATCAT
CCTACGTACGAACGAAAAACCCACCCGAATTTTGACCCGACCAAATCAGGAATCAGAAGACGCCAAAGTTGCTGCAGGAATCGCGTCGCGACGCGAACCT
GATCGCAACACTGACGATGAGATTCAAGACGAGTATACGGGTGGGAAGACCGACGAAAGCAAGGATGATAGATTGACAAAGGGATCGTGCGCGGTCAACG
CAGTGCGAAGACCCCAGAACGATCGAGTGAAGTAGACGAAGTCGCAAAGAGGGACATAACACAGGAGGTCGACCATGTGACAACTGATCCGCTACAAGGA
CAGTCCAACTTCCAGCCAGATGAGATCAAGGTCGAGGATCGGGAAGTCCACGACCAGTACACACGATTGGTCGACAGCGCGGAGGCTGCTGCGATTGACG
ATGAAATGCTGAAAGGAGATATACCGGCTCCAGCAATATAAAATCACGAAGGAGGCAAACTGTTCGCGGAATATGTGGAGCAGCATATGGCTGTACTACC
GGAGATAACGACATCTACGACGGAGATAACGATTATAGATGTCCAGGTTGGAGATCCTGGGGCACTCTTATCAGAATATCAAGGGGATTTGCAACAACTG
ATATGAAAAAACATCACCTGTTGATTGGAAAGGGAAACGCGCTACCCCCTGCAGCACGCGTGGCCGTGTGTGATATTGATGTAGTATAGGCAAGGCCGAT
CGCGCAGCGTGTGCGACCGGTTGCGCCGATATTTTTTGAGAAGTTGGCTGATCTGATAAAGACCTGTTGTCGGCTAAGATTATTCGAACTTCGACATCGC
CGTGGGCGTCACCATTAGTCGTTATCATTAAAAAATGGAAATACATCCGACTATGTAATTACTATCGACGAGTGAATCAACTAACACGGTTGATGATTTA
TCCCATGCCGCTTACTAACGAATTGTTGCAAGATATGTACAAGGCAATGTGGTGTTGTTCATTGGACATGGCTAGTGGGTTTTGGATGGTGCAGATGACC
GAACGAGCAAAGTTGATCTCTGCGTTTGTCACACCGTCGGGTCTGTTTGAATGGTTGAGGATGCCTTTTGGACTGAAGAACGCTCCACAGATTTATCAGC
ATTTGATTGTTAACGCTTTATATGAATATCTCAACTCCGGCGCGGGTAAGAAGGCGACCGCAACATATTCCTCTAGGTTGACCGATGTGTTTACTGAAGG
AGAACCAGAAACTGTCAGTGCTGGGCAGAAAATCTTATATTGATGATCCCAGCTACGTCGTGGACTTCCCTGTACAACGAGTTAGAGCGACTACTGACGG
TATGCGATCGATGGAAGTTGTCGATTAGCTTGACCAAGCGTTTTTGAGGGCGGCGTAGGTGAATTACTTGGGTCACCAAGTATCATTGGCCGGGTTGGAA
GCATATTCTAAGGATCTAGAATCGCTGTTTAACATCCCCTTCCCCACAACGCTGCGTTCCATGCAATCCGACCTGGTTAGTTGGAACTACTAAGTCTCTT
TTTTGAAGATTTTGCAGTTTACACATCTGTGTTGTACGAGCTACGAGAGGCAGACTTTTTATAGATTAATCATATGGATGATCGTGTTGAGATGGCAGGA
GGTCGCGATCTCACCCTACAAGGAGGTGATCTTGATCTGAATGAACGATCTCGGTGGGAAAAGTCCATTATCGCATTCACTCTGTTGAAGGCCAAAGATA
GCTACTATCCCTATCCTCAAGCACTTCAACCTAGATCGTGGTATGTGCTAGCAAGTGGGCCGTGTCGGCATTCCTGCTGCAGGAATATGATCGCGTATAC
TGGCCGGTAACATTCACGAGCCGTACACTAAAGCCAAATGAGATTATTAATGGCATGGTGGAGAAGGAGGTGTTAGCCTTGTTTCGAAATTTGGATGTGT
GCTATACTATGCTATTATCCCGGGAGATCAGGTGCTCACTCGATATTCGACACTAGCCTGGCTAGTTCAATCCCCCGACCTCAACGGGAGACTAGGATGA
TGGGCCGCGCTGCTATCGAGTTGGACACTGGAGGTTAGGAGATGTGAAAAAGGGGAAGATGAAATACTCGGCACACTCGCAGCTAGCTTAACTCCTCGAG
AAGACGTAGATGAGATGTTGATCGTGATCTCTTCAAAAATTAACCTAAACATATTGTAACCATGCCACCCTCATGGTGGAAACGGATGAGAGCCTATAGG
TGGTTAGCTTCGACGGATCGGCCCGAACAATACTAAAGATTGGGTCGTATAGCGCGATCGTATGGAAACTACCAGAATGGGCGATTATCGCGGCTGCTTT
GGAATATGCAGGGCATTTAATGGTGAATGCAGCTGAATATCGTGGTATGTTACTGAGTTTCGACCTGCTGGATGGCCAAAGTAGGGGACGAGTCATTATA
TGTGGTGACTCGAATATAGTGATCCAGAAGAAGCAGGGTGAATTGATTGTAAAGCGCCCGGGTTACAGCTGCTGCGTCACAAGGCGATGCAGAAACTTCG
ATCATGGACTAAGCACGAGTTCTTACATATGAAGCGGGAGTGGAACCAAAGCGCAGATAGACTAGTGAGTGCAGCCTTGCAGCAAGAGAAAGTCACCATC
GTAACGTCGGATCAAGAGTTACAAGATTTGATATCACTCAACCGACTGGGCGAATTGTTTATGCCAAAAAAGGTGGACCGCGTAGTGAAGATGGCAGCGA
TCATGCGATCCGCGCAGCGAAGGCGTCAACAACCCGAATTCTGCAAGAAGAAATAGTGCAGCAGATGCGGATCGAGAGGATAAAGCAGGCGCAAGAAGAA
TAAAGCTGGATCGCCAACCTGAATGAATATCTTATAGGCGACTTAACCCAGTTGAACGCCGAAGATGCAAAATTATGCGCTCAGATTGCTTTAGACTACG
AAGTCGGCGAAAATGGATTGCTCTTTTTCACCCTTCGATCCTTTAAACAGTCGGACGATCGCATGGAGATGGTCCGTCTGGTTGTTCCAAATTGTTACAA
CAGGACTTTATGCACCATTACCATACGAGCTTGGAAGGTGGTCACCGAGGGATCGGGAGGACATATCAGCCGATCAGGTCTAATTTCCATTGGAGGGGTC
TATACCGGAGTATCTAGCGTTATATTAGCGAATGCGTGGACTGCACGTCTGGGAAGGGGTTACCCGCAATCCGTGGCAGATCCCCTGGGAATATACAGGC
TACATACCCATTTCAGGTAATCGCAATGGATCACATCCCGTCTCTGCCACGGTCATTCAAAGATAACATCGAACTACTGCTGTGGGTGGATCTCTTCTCG
GGTTAAATGACCGTGAAAGCAAGTTCGTCGAGGACCACACAAGCTATCGCTGAAGGCTATGAGGAATGTGTATTCCGAAGATTTGGAGCAAGTGAAGCGA
TACGTCACGACCGGGGAGCCTGAATTTATGTTATATTTTTTCGAGCGTTTAACCGGATCGCAGGGCAAAAGCAGCGTGCGACCATGTCTTACTGACCACA
AGCGAATNNNNNNNNNNAACG