Description :
From Genome Similarity Track
Location :
Scaffold_769:7737- 8918
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_769-fgenesh-gene-0.2Ankyrin
Pytul_var.sporangiiferummaker-pug3_contig_769-snap-gene-0.11E3 ubiquitin-protein ligase UPL6

Sequence
1181 bases(100 bases per row)
AAGGCTGCACTGTGAACGCCATGTCGAATGCCGCTGCAAATGGCCACTTGGACGTCGTCCAGTTCCTCCACGAGCACCGTACGGAAGGCTGCACGACGTA
TGCGATGGACCAAGCCGCGGCCAACGGCCACTTGGACGTCGTGCGCTTCCTCCACGAGCACCGTAGTGAAGGCTGTACGACCACCGCGATGGATGCCGCA
GCGGGCAATGGCCATCTCGAGATTGTCCAGTTTCTCTACGAAAACCGCAGCGAAGGGTGCACGACGGATGCGGTCGACGGTGCAGCGATGAATGGCCACC
TCGAGGTCATCGAGTACCTCTTTCCGAACCGATCTCCGGGCTGCAGTTACGAAGCCGTGCAGTACGCCGAGAGCCACGGTCACGACGAGATCGTCGGGTA
CATCATGGATAACGTCAAAGCCGTCGAGAAGTACGAGGAGCCCACGCCGGAGCTCGAGCTTCTGCAGATGTTTGAGCAAACGCTGGGTTTCTAGGAACCA
CTGATCCGAAGAGACAGCCAATCTCAAGTCTTGCCTGTTGTTTGTGTTATATACACGTTAAATGCGTAAAGTTTGGTTCATACGTACATGGAAAGTGTCT
TTGCGTTTGTGTTTTACGTCATTTCAAAGCCAGCGCCGGATGAGATCGAGATGAGAAGCTTGGCGCGGAGCACCTTGTAGGACGAGTACGTCGGGAGCTT
GAGCGTGTTGAAGCACGTCGAGGAGCTTGGCAGGAGCTCGTCGTCCTGGCGGATTGGGATCTTCTGGATGCAAAACGGCGGCGTCAGGCTACTGAACCCC
AGTGACGGCGCACGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGAACCACGCCACGCGCTTG
TCCATCGCGTAGTACCCGCCAGCGTACTTTGTATTCGCCTTCAGGTCGTCGACATCGATGTGCCCACCTTTGCCCGAGATCAGCACCTGGAGCTCCGGTT
CGTTGAACATTTGCAGCCATCGGACGTCGATGAGGTCGTTGAGACCCGCGCGGAATGCTGCGCATTGTGATCGAATCTGCGTGTTGAGGTAGTAATTGGC
CACCAAGTGGATGTATCGCGTTTTGTTATGATTGCTAACCGCAATGTTGCCACCACCTAGTGTCGTCAAGCAAAACACATA