Description :
From Genome Similarity Track
Location :
Scaffold_187:77358- 78545
Transcript NameFunction/comments
g9593.t1hypothetical protein

Sequence
1187 bases(100 bases per row)
ATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCATGAGCAACTGCCG
TATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACCAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATAC
GAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGT
ACAATCGCGTTCCTTGACTCGGTTGACCATCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACC
CATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCATCAACTGGGAGTAGCACACTTTCAACACCAGTAGTAGCGCTAAGACCTCCTTCT
CGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGTAACTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAA
TGCCCACTCATTCGCGAATAACGTGACATGCGCCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCCGTTGGAGCGCGGCGAAG
CTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAATCCTGGATGAATCGAC
TGTAATAATTCAGCGCACCGAGGAAAGATTGCATCCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAAT
ACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGG
AGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGG
ATTCATCCGGCTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGC