Description :
From Genome Similarity Track
Location :
Scaffold_812:7734- 9794
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_812-snap-gene-0.7Alpha mannosyltransferase

Sequence
2060 bases(100 bases per row)
CGGATGCCACGAGAAGAACTCGTTGAATGCTACCATGTCGAGGATTGGTGGCTCCTGCTGCATGCTTGTGTACAATGTGGGAGATTGATGTACCTCCACA
ACAAAGTCGGCGCACTCGCGTAGCGTCCGAAACGACCCACAGTCGATGAAGCTTCGAGGGTTAAAGAGCGTTGCGACAGATGTGGAGTTGCCCCAGTAGA
TCGGGATCGCGCCGGCGAGAAATGCGTTCACGATCTTCTCCGTCACGTAGCCAGGCGCGATCGAGTTCTCGAATGCGACAACGAATTGGTAGCGTTGGAA
TTGCTTGACAGCGTCATCCAAGTACCATTCAGACTGTCTAGAGGCCAATTTGCGGAAATCCTTGCGCGTCGACGCCCCTGCGCACGCCCCAAGCGCGTCC
ACCGGCTTCAACTCGTTCAGCATGTCAAAGAAGTACTGTCGATGAGGCCACTCGCACTGCGAGTACAGGAACGCACAGAACTCCCGGTGATGCATGTCGC
CAATGTGGGATGGGGAGAGCAAATCCAACGGCGAATGGTCCAATCGCTCCGCGAACGAGGCGCTCGCCATCGATATGTACACACGTTTAAGCTGAGATGT
GTGGGAGACAGTCGATACGAGAGTAACCGAATCGTCCAAGCCGTCAATATTCCACGATTCGCCCGAAAACACCATGATTCGGGCAGGATGGTCGCGGTTG
TTGGCCACTGACATTCGGCAATGACGGTGGCTACACGCAGCGTCGAGGATCGAAAACACGTACACATCTGACTCATCGCGGTAGTGTCGCGCGACGATCT
CCTTGCCGACCACAACAACGGGGTTGTCCGTGTACATGGCGGCGAAGAGGCATTCAAGGATGATTCGGTGACAGGACGCTTGGTTGTGGAAGCCGATGAC
AGCTGGTGGCGCGTTTGCATTGGCCACGAACAGATTATGACGCCAAAGCTCAAGACGCGATCGATCTAACATGCCGCTTGCTTCAGCTTTGATGTAAAGT
TCTTCGAGGTGATCTCGCAGTTGCATCTCAACGCTCGAGCAGTCAATAATCCATCGTAAAAGCAGTTGGCGAGCGTGAGCACACACTCGACGGGAGAAAT
GAGCAAACGTCTCGGCTGACGGAGTATATGTGAATTCGACACCATTGATGGTCATGGCTATTTCGATGGTGATTGTAGTCCGAATATCTCGTACCAAGGA
CATGAGCTCGAGTTTAGAACTGCGGCGCCTTAATTCGTGACTTGTGTCGTCTTTCCGCCACGCGAGTGAGTGGAACCCATGGCAGTACGCTCGACCGGCC
AGCAGATTCGAGTGGACCATGCGAATTCCCAACGGTGACAGGTCTGCAAATGAAATCAAGTGTTCTAGACACTGGCCGCTTCGAAGGTGCAGAAACTTGT
CCGTGTGTTGAGGGTGTACTTGTATGGCCAACAGCCACAGCGCGACGCTGATGTCATCCATGCCATTCAGACCATGCAGTCTCTGTCGGTTCTTGGCGAT
GAACTTGGCGCAATCCATCGATACGACGTAGTGTGGCCCGAACCCGAACGGGGGCAGATAATGCATTGGGTATACCGTCTCAGACAGGAAGTACCGTCGA
GTGGTGTCGCGAATAGGTCGCGAAGATCTGTAGTATTGACGATCCCATACTTGGCTGAGATAAAGACGCTCTGTTTGGCCGCGTCGGACGAGTTTCTGCT
TCAACTCGTCAACTTGCAGGTGAACGTCATCGTCGACAAGCATGACATACGTCGCTCCACTGAACATCTCCACTGTCCAATGGATAAACTCCTTCACCTT
GCTGTGCAGGTCACTGTAATTATCGTTGCAGTCCAGTTCGTCAGTCAGCAAATCACCAAACGCTTGTTTCTCGAGCGTTATTGCTCGTGTCCATTCTGTC
TTTAGGTCGGGTGATCGCAAATCGTCGAAGTTCGACCGACAGCCGATGAAAACCACCCGAACGTCACTTGGTAGCGAGCTCGCACTTGCCCATGTCTCCC
GTATTGCCTGCCGGAGGTGAAAATTGGTTCTCACGACTGTTTTCACTCCAATAACGAGCA