Description :
From Genome Similarity Track
Location :
Scaffold_150:77322- 80290
Transcript NameFunction/comments
Hyaar_Emoy2811222hypothetical protein
Hyaar_Emoy2811223hypothetical protein
Hyaar_Emoy2811224hypothetical protein

Sequence
2968 bases(100 bases per row)
CACGTTACTAACTGCGGGTTAGTCGATACCCTTAGTAAAGTAGCCTTACACAAGTATACATCTACACAGTTAGGTACACACTGCAACCAAGATAGCGGGT
GCAGTGGGTCGTATTCCTATTTCGCTAATACGTAAGTACAGACCCATTTTTAGCCAATAGGATACGATGTTCTTTTGAGTGGCTCTCATGGCTTCGATAT
CACTCGTGCTGATTTAAAATAAAACCAAGGAATATAAAAACCAGTTGAATTTAACATAAAAAGCACACGTTAAACACATAGGCTCTCCATATGCTTCCTC
GTAAGACCATTAGTGGATGTATACGTAAAGGGGCTCTCGCCCCATTACACCTGTAGCACTTCGTAGTCCTTCTAACGATTAGCGCTCTGTCGATACAGGG
CGCTGCTGCCGGGGGGGGGGGGTAGGACCACGGTGACTTCAAACACATCACCTTTTTTGAGTGGAAGCGCTACGACGCCTGGAAGTCGTAGCCGGCATCA
GTGCCGTGGCCGCCCTCTCCAAGGACACGACTAAACATCTACAGCGTGTCGCCATCCAAGGTTTTGTCGACCGTGAGTTTGCCGATGTAATTCGACGCAA
TTCGGCGAGCTTCAACTCCCACGGTAACGACGACGTTAGAAGTCGTAAAACTCGACATTTCAAGCTATAGCGGCGAGGGTCCGAAGCACCTCGCGCTCAA
TCGCTGGATGTGCAAAGTGTACATCACTGTCCAAGCCCGCCAGCTTTCGTCCGAGTTTGCACGCACCCACTTCCTTCTTTCCAAGCTGACTGGAAAGGCG
AAAACGTGGGCGCTAGTAAATCATCTTGTTGTTGATCCGGGATGTTTCCCGGATCTGAAGGGCCTAAAGGATGACTTGCGGCTGGCATTTGAGCCTTCGC
AAGATGAGCATCACCATCTCTCGGCTTTCCTCACGCTGAAGCAAGGCAGCCGGTCGATGTTGGATTACATCGAGCGGGCTCGACACCTGGCGTATTGCAT
CGTCCCCAATACAATTGATATGGTGACGCAAGTCCACGATTTCGTCATGGGTATGAACACTGATCATCAGCGTTTCTACTTGACGCTGAAGCCTTCGTCG
TCGCTCGAATAGGCGTTCACTATCGCGATGCGTTAATACTTAAGTGTCATGGCTTCACAAGTAGAGCGCTCGTCTCACCATCGCAACTCTCGAGAACCTG
AGCCTATGGACATCGACGCGAATGATCGTGATCCTCTCTCACGGCGTACTATTGGCAGAGGGTTTCGAAAACACGTGGCGATGCAGCAATTAGTTTGCTT
TTGCTGCTGTAAGCCTGTTTATTGCGCGGCGGTTTGCCGCGCGCCTGCCCCTTTTCTCGCTGTAGCTGATTCTGACTCCTCTGTCAGCTTTTCTGCGCAG
CAAAAAAAATGATAGGAACCTGTAGGCGCGAGGTGTCCTACTGGAGGAAGCGGTAGGAACGTGCCCAAGGTGGCGACACGTTTATCTAGCCCCAATGCGC
ACCACGCACATCTTTATGCCACCACGTCCAGAAACAACAAGCGATTGATCGTGCTTAGTGTGCACGTCGACGGTTCGACGCGCCCTCTCCAGGCATTGTT
GGACTCAGGCGCGACAAACAACTTTGTTCGCACCAACGGCTTAAAGATTCTCCCCCCGCGGGCAAGTATCCGGGTACTGTGATCGTCACGTACGCCGATG
GTAAGCCGCGGACACACCGACAGCGGTCGGTCGTCGTCCCCTTCCAATTAACGACTTTACAAGTTGCGACGAGTTTTAAGTCATCGACCTTAGCGGGTTG
CTCGACTGCATTTTTAGGATGCCGTGGATTATACGGCATCTTCCAGACATAGATTGTCTTCATTGAATAGTCAAGCCGCGTGACTTTGACGTCAACACCG
TACTCGCAGTCCTTGCCGAACCCGCGAGTACCTGGCAGCATGTTGCCGTCGTGGATCCAATCTCCACGAACTTTAATACCCGCGAAGCGTGCGATGGTCC
TTCGCTCGCGGTATGCAACACCGCGACATGCTCCTCCTCAGTCGAAAAGTAGTTCCTGAGTCAAGAATCCGTGCCAAGGCAACGGCCTTCGGCGTCTCAC
GCACGAGCAGTGGCTTCCGTGTGTTCAAGACCTCACAAAACCGCACCGAAGCAGAGGATTCCGGTGCGTCACGTGCGAGCAGTGGATCCCGTGTCTTTGC
AGACATCAATTACCACGTCACAACAAGGGTTATCGAAGTGTCTGTCTTATATCCTATTTGCACCGGAGCAGCGGCATCCGGTGCGATACGAGCGAGAGGT
GGCTATCGTGCACGTTCAAGCTGGCGACAGTCCACGAGCGCTGCGGATCTCGAAAACTTACACGGGGCTGTGGCTTCTCCGCGTTCTGTTATGACTTAGG
CTCGTCTTTGCATTTCTCGCTGTCGTCGTGGACGTTGTACGCGTGTTCGACTTCGTCATGCGACTTCCGCTTCTCGTCCGGCCTTGCCGCTCGGCACCAT
TGATGGCTTCAGCATGCCTGGTTCGGGTCCGCGCAGCCATTCGCTTCAGGTCGCGAGTCCACCTCGCGACGCGCCTGGCACCACGCAGCTTCCGAGATCA
CTTGGGAGGAGTTGCTACGTGATATGAAGAGGGGGAGGCTGACCAACAATGCTTGGTGGTCCAAGCTTCGAAAAATGGCAATCATGAACGCCGTGCAGGC
ATAGAACCAAAGTCGGCACGCGAAGAGCGGCATAGTCATAGGAAAAAGTTTCAGCGTCTGAGAATCTGGCTCTTGAACGCGCCCGCGGGTTCGCTGACGT
CTTTCTGGACAAGATCCCAGCAGACCGTGGAGTACGGCACGAGATCGATCTCGTGCCCGGCTCAAATTACTGCGTCACCGCTAGTGGCTGCTTCCACGTG
ATCAATTGTAAGCCATTGATGCGTTATTTAAAGGAAGCTGGCTAGCTGGACACGTGCGCGAGAGCACG