Description :
From Genome Similarity Track
Location :
scaffold_882:7731- 8886
Transcript NameFunction/comments
g10531.t1 hypothetical protein PHYSODRAFT_564322

Sequence
1155 bases(100 bases per row)
ACAACGCGTCATAAGGTAGCGGCATATTGGGCAGCTGCAAAATGGCCTTCAACTTCGAGATGTCGCCCAATTTCTGGTCGAATTCGGCGCGCGAATGCGT
CCGCTGCCTTCGAGCAGCGAGACGTCCACGTACAAAGGTCCGCAGCTTCCGTGCCGCCGCCTCCTGCTCCTGCCGCCGACCTCTCGCCTCTCGCTGCTCT
CTCGCCAGCTGCAACACGCGCACGCGGTCGTCCCGCCCGCCCCTGCGCGCCAGTTCATCGTCCCGCAGGAACATCTTCGCGTCAAGGTCAGTTTTCACAC
AAATCGTTTTTGTTTTCAACCAATTGAATTCAAGAAATAAAATGGAAAAGTAGCCAATCACTGCTTCAAGTTGAAGCGAGCTACACGTCGTGTAGTACGA
TGCACGATGCCATAAAGGATCGCGCATGCGATCATCAGCACGGGTGTGTCCATCATGTGCGGGGCCATAGCCTCCGCGTACGCCATCGTCGGCGCCAACA
TCAGCATTAACAGCAGCACCTGCCAGAAATTGTCGAACGCCGCGTAGAGGATACGCATCAGTCGCTGGTATGAGCAAGGCCAATAAACTGCTAGCATCAC
CGATTCGATCCACTGTTTCAAGTTGAGATTGGCTAACAACTGTGACAATAGATTCCAAACCTCCGGACGGACATCGTGTCACCGCAGCCCACATCGTTTC
GCGATACTCAATGCGTTTATCAGAGATTTTGGAGAAAGACTGCCACACAAACGCACTGGCGTTGTAGGGAGCACCCCTTTCCATCCGGTGAACAACGGCG
TAGGAGTCAAGATGCATGAAGTCACCCGATTCTCCTCGAATTTCCCCCCGGAACTTCATAGCGCAGACGTTTGGCAACCGATCCAGCACGTGCGCTCCTG
GAGCGACTTCGTTAACAGACAATAGATTATTGAACATCTAACTGAACAGAGCCACAATTAGGAAATTGAATTCGGCAACCGAAACGAATAGATTATTGGT
ACATGTAAAAAAGATTGTATTCCGTACGAATTTTTATATAACGTTTTGTCCCCTTACATTATTGAAGTCTTCTTCTCCATCCCAATAAATAACTGGCGCT
TCACCTGAAATCAATTATTGAAACAAATCTATTGCAATCAATTTATTATTCTGCT