Description :
From Genome Similarity Track
Location :
Scaffold_158:77297- 78543
Sequence
1246 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGATATTTGGAATTCTCATTTG
CTCGGAAATGACAATGCGTCACATGAAATCTTTTGCCGTTGTGTGAGATTGGCTTGACCAATACTACGTAGTATTTTTTTAGATTTTCAGATTCAGTAGT
GTGAAATGGATACAGAATCCAATATGTTTAAGTCTATCGAATTTCAAGTCGCAATCATCCCTGGACAGAGGTAGTATGTTGTCAGTCCACCCAGTAGGCT
GTTCACCAAATCGGTTAATGTGTCTTTGTGAATCTCACTTGTCCAGGGAAGTTAATGGCATGACTTGTGTATATGACCAATTCCACCAGTACGTAAGGAA
TTACGGGCATCAATACGAGTTCGGAGTCTTGTGAGTAACGTTGCGACTTACGATCCCTGAGCTGATCGTGTATTGTTGTTCATTTAGTTCGACGAGTTTA
ACAAGTGTGAGCGAGAGGAAGTCCACCGTCATCCAGGTACACCCATAGCGCCACGATCCAAGGGTATTTATTGGGCGTGTTCGCTGTATATTCTCGGGAT
GGTCGTCCTCGCCAATCGAACAGTTCCATCGGGATCATGATCTTTGGTTGCGCATCAGATTCAACTAGATACTCCTGAGGTAGGTTGGTACCGACGGCTT
TATGTGTTACTGCCGGTCAGCCGCATAGCACTGCGTGTCACCACAGGGCACACAATTCGGGAGAGACCATATGTGGCGCCATTGAGTTTGTCAGACGGAT
GGATTATCCTGTAGTAAAGCCCTTGGAGTTCCATAGCCCATCGCGCGAGTTTGTGGTTGCCTGACCAAGTGGCCATGTTGAAAAGCGAAGTGAGGGCATA
CTTCTAGTGCATTCACAATTAGTAAATACTTCTACTACACCAAACTGTCACTGAGACAGAGTCTTCGTAGATGAGAGACTGGCAACCAGACGAGGCTTTC
TTCCCCATCGGCAATCATTCACTGTATCATGGTCAGTCTCTTTTGACTGCGGACACCGCGGATTCTTCGCGGAGCCACCTGATGGTAGGTCAGCTTGCTG
TTTTGTTTGCCTCGTGTCCAAAGAGTAAAGCGACCAATTTCATAGT