Description :
From Genome Similarity Track
Location :
Scaffold_8:77296- 78329
Sequence
1033 bases(100 bases per row)
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCCCAGAGGAGTCCAGAGGGTACTGGAAACATCATTCGCCAGGTAAGTGGTTCCGTCAGGCCAAGATCACTGGCAAGATCAACAAT
GAGAAGTCGATCTTATTCTTAGACACCGGCGCCGAGGTGTCCATCGTGGACGCCGCCTTTGCTCGTAAGGTGGGGTGCTATGTCGACACGAGTCAGAGCC
AGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGAGGAAGGAAGGACCAGGATCAAGGTTACGCTTGCGGGATCGCTGGTGTATTTCTTCGATATCTGG
GTTGGCGATCTATCAGGACAAGAGGCGATCCTGGGTATGGACTTTATGGTTCCAGCGGGGATCCGTCTCGATCTTGCGGACGGCTCTATCTGTCTCCCCG
ACGAAGTCAAGATCCAGCTTAGCGCACGGCGCCAGCTGTACAACGACAAGGTCAGACACGTGTGTGTAGATCAGGGAATGATGATCGCTATCGGAGATTC
GATTGAGCTTCCGCTACGAATGAAGGTGACGGATCGAGAAAAGCTATGGGTCACCCGTGGAGATCGTTGGGTGCCGACTGTGGTCCGAGGACCCAGCAGG
ATCAGATATCGCCAGGTTACCAACATCAGCGACAATGACCTCGTCTTGCATCGGAATGAACGGATCGGGATGTGGCTGGCTGGAGATCGGATACCCCGGA
TCCCAGGATATGTGTCGATCGGATCTCGTCGATACATGGAATGGCAGAATCTAGCCTTTCAAGCCACGACAGATGACCGGCCGACGAACCAGGAGGCACC
AACGGGACCTCCAGTACCTGCCGTCGAGCGACC