Description :
From Genome Similarity Track
Location :
scaffold_83:77283- 81181
Transcript NameFunction/comments
g3080.t1hypothetical protein

Sequence
3898 bases(100 bases per row)
CGGACCCGTCGCGTCTGTCGGACATGACGCAGCGTCTGAAGCCGAAGCTTAAAGTGTCGGAGAGCGGCCGCTTCGAGGACCAGTTCTACCACGCACACGA
CGGGAGCAAGGCTATGGCGAGACTGCGTAAACGCGCATACCAGAACAAGACGGTGCACATGAGTGGCAACGACGTGGAGCAGTTCTCGGACGCTGACATC
ATCACCAGTGGCTATCTCGTCAAGCAAGGCTCCTTCTGGAAGTCCTGGAAACGCAGGTTCTTCATTCTGAGAAGAGACCGACCGGTGCTGTGCTACTACA
CGTCGGCTAAAGAGTTGGCCAAGCTAGGAGAGATCACTATTGATGAAAACACCAAGGTGGAAAAGGAACCCACTCCCAAGGACAGTTTCTTGTGGAGGTT
CACCATTGAGAACGAGGGGCGCAAGCTCACACTGTCCGCGGAGCAAGGAGACCAACAACAGGACATCATGGACGCGTGGATCTCGTGCATCAAAGGTTGC
ATCACACAGCGCGCGCGATCGACGTCTCGTGCGACGATGAATGGGTCGTTCGATCGCCGATCGGAAGGCGGATCCTTTCATACACAGCTGCAAGCGCGCG
TCTCGGAGAGTTCACCCATGCTGGAAGACCTCGATGTGGATCGTGCGAGTTTTTCACGTATGGAGAACCCGCACATCGCCAGTGGCATGAACACGATGAA
GCGTTTCTCGACGGATACGACAGTTATCCAGCAGGCTGCTAATGACTCTAGATCCGTTCGAGAGAACGAGGAGAAGCAAAAGAAGCAACATCAACAGTCC
CGGCAGCACCGGAACTCTCATTTGACCAGTATTGCTTCCGCTCCATTAGATACAGCGAAAGCTAAGCCCCGGCTGGTCCGCTCGTCCAGTGCTGGATCTA
TTCTCACGCAGTCAGCGTCGTTCTCCGTTGCTCCTCGTGCATACGACGACAATGGCCTGTCGATGATGCACTCGCCTTCTCATTCAGCTAGTGATCTACA
GGTGACGCAGATTACGTCAAACTCTCCACGTGCTCCAAGCCTAAGCCTGCCAGGATTCAAGCCTCGCCCCAGTGTGGAATTAGCTGTGTCTGTGGGTAGT
AAGGCTGTGCAAGATGTCCCGCAGATGTTGGTGGTTTTGTTCAACATTCGCCAGGGGCAACGACCCGAAGAGATCTCACGAACGGAAATCCGGAGTTCGC
TTTCTCTTCGATCTTGTGGTGGTGACTCTTACGCCCGTGATTTCAATGCTTTGCTATCGGTACCGCGTACGGCGCGCTCGATGCTGCAATTTGAAGTATA
TTCAGTGGTGAATCCTTCTTCGGAGGCTCTTGAGAATCAAAAGTCGCTCGGATTTGTGCGAATGTCGGCTCTGGATGTCCTTTTCTCGCGTGGATCATCG
ATGCTGCTGGAGTGCCACCAGCCGGACACATCCAAGCAACGCTACTATCTTGCTGTGGACCGGTTCCAGCCGCCTAGCCACAGCATTAACGTGAGCCACG
CGTATACGTACGCAAAGCACCATTTTTTGGTGGACACACAGGTCATGGAGAAGCGCAAGTCTGGTGACATTATGTCTAGCTCCACTATGAGTTTAAGGGG
TGGACTGAGCTACAGTGAAATGCTTCGTGGCCAGATGAACTCTTCGTCCGCCAGTCACATACTAGTGACTGAAGAGTTATCAACGTCTTACGTTTCAGTA
TCGATGACCGTCGCTTTTCTGAAGTATCTCCAACGACGGAATGTTACCCGCATCGATGAGGCTAAGCAGGTGGTCAACGACATGAGACAGCATATCCAGG
CGAACTCTGGCTCAAATTTGGCGAGCACTCGCGTTCAAGAAGTAGAAGATCGCATGCGAGATGTGGAACTTGAAATGGCTCATTATATCCGGCTTCACGC
CTCTTATAAAGAGAATCTCAAGCGTTACGAGACGATGTTTGCATCGCTTGAAAGTGGACGGGAGCAGGGAATTACTGGATGCCTCAAGCGTAGCAACATG
AAGAAGGACAAGGCCACCTCATTCATGGCGACTAATCTAAACTGCCATCTTGTGCGCGGAAGGCGTGTGCATCTTGCTGACGATGTCGAGCGGAGTGAGC
AAGCTCGGAGAGGGAGCTTAACGTCTACGTCGTTGGATGATGGATCTGGATCTGAAGACAGCGACAGCGAGACATCTCCTATGTCTGAGTTCGTGTACTC
AGTTGTTACTCACGGTTGTGCTTCAGCGCATATTATGGGCTTTAAAGAGGGCGGATTGCGTCGTCTTCAGCAGCAGCTGGCTTCACAAAGCCTGCCTGAC
CCGCGTCTTCGTGAACGTATTGAAATGAGAGAGGATGTGGTGCGTTCTCAAGTGTTGGCAATCGCTGGTGCTTCGTTCCTCAACGCTGTGGGCCTGGCAG
CAACTCGTGGGGGACAGCATCGTCAGCGGTTGCAACTTGCCTGCTCAACAGGGTACTTGCTCAGCATCGAATCATTGCTGAGTACCGTTGGTGCTGAGAA
GGGTATGCTGGAAGATATGTCGGAGGGTATTCGGTGGCTCAACAGTGCAGTGAGCTTTCAGCTTGTGCAATCTGGAGAAACCAACCCTCACATGGAGATG
TCCAAGTGCGTTAGCGTGACAAGCACGCCTACCGGAGATCATGTCGTGGTCGCATTCGCAGTGCCACCTGATGTTTTCTCTAAACTCCCGGATGTGATGC
AGCAAGGGCATGCAATAAAACTCCACGGTGTGATGTTCACTCAAGGGATAAACGAGATGCAGTCCGTGGCCAATCACTACTTGAATTCCAGTCTCCAGGA
TGAGCTGAATTTTGAGAGTGTGCAGATGCTACAGCGATATTTCCGCGTCTACCAGACTCAAGTGAGTGCTGGTGGGGGCGATGACAAGAAGCGCGAAGCA
GATCTAGCTGAGTTAGCCGAGCTTCAGGCAGAAATCGAAGCCCTCACTGGTCGCCTCAACACTCGCACAGAGAATGTGCAGAAGAAGTATGTCAACATTC
TCATCGCGTCCAGCGATATCTGCCGCCGTCTAGGAGCCGGGCGTACGACGTGCTGCAAGAGTGGGAAGGACCGCACGGCGATGTCGGTGACGCTGGAGAC
ATCTCGGCTGCTCGTGGACCATTTCCACGTAAAACAGGGCGTGCATCTCTGCAACGCGATGAGGGAACGTGGTGTCCGTCGTGTGAACGTGCTGGCCAAC
ACCGGCAAGACGAAGTTTGCATTCAACTCGTTCCAGCTCAAGTACATTCCTGACTGCTACAAGCCGCCGCTTGCCTGTGCAGATTCGCACGTTGCCTCTT
AACAAGTCTGGATGAATGGTCAATTGCAAATGGAAGGTGAGATTCACCATGTTCATAAACCCTAGTTTGAGCTCGTTGTACTGTACGCTGTAGGATCGAG
GTGTCAATCCCACAATGGATCGTTCATCATTTTGAGCTCCTTCTCTCGTTTCCGGCTTCGCTGCAGCTTCTGGACCTGTTATCGCCCCTCAAGTTAGCAT
TTCCATCGGTAAGATGCACAATTTGTGGCCAGCTACGCACCGCGAACCAAAGTTTCTGCTCGTGCTCGCGGTTGCTCTCCTCCAGTTCTTCGACTTTAGC
TTGGAGGGCAGCCACCTGTGGATTGAAGTGCAAGGCTTCGTGGAGCTCAGTCTCGAGCTGACTGATCTGCTCTCGGTACTTGTGACGGAGCTCGTGCTGA
CATAACGAAGAATGAGACGCTGATTCAACACAGCAAGCATTGCGCTTTCCAGTTTACCTGCTGATGAAGCAGTTTGGCCGCGATTTTCTCCCCTAGATCT
GCTACTTCTCTGTGTTGAGTCCGCAAGGCGTCCTGTTGCCCCAACAGACGAAGTAGCAGTTCGTCCTTTTCGCGGGACCCTATTTTCTGCAGTGCTGC