Description :
From Genome Similarity Track
Location :
Scaffold_936:7728- 9644
Sequence
1916 bases(100 bases per row)
ACAGGACTTCTGTATAACATGGTACAGTCTCCGAGTTTTAAGGCATTCATGCGGAGCGCCACGGGTAAGCCGGCCGTTGCTGTTCTAGCTGCACCGACGT
TCAACCATTTCCTCGATGCAGACTTTGACAATTTTTGCAAGATGCTGGAATTGTTTATCAATCAGAGCACGATGCTGCTTATGGTTTGAAGTTCATCACT
TTGATGCATGATATATGGACAAATGTGTCTAAAGAGGTGTTGTTGGAGCCTCACCTGCTTTTATCGATCAGAGGTGGCAGATTCACCACATCGCAGTATT
TGCAACAGTGAAGAATGATGGGCATCAGTCTAGACAAATCAAACAGCTTATTGAATCTCGATGGAGGGACCGCTTCAATCTGGAGACAGAGGATATGGTG
AAGTTTACCATTTCAGACACAGTCCCGCTGCTAAAAAGGTTTCAAAGGAGTTTGATACAACGCTGCCAACAGATTGTGTCATCCACGTTTTGAACTTGTG
CCTTATATATGGTTTGGGGCTTCGCGAAAGTCGACAGACAAAATATGTGGTGAACAAAGAGTCGAAAAAAGTAGAGAAGAAACATGTAATTGTGACTCTC
AGTGGCGCATTTCGGGAAGGTAGTAAGCTGATCAAAAAGATTCGCAAGCTGAATAACTATCTCAGCACTACCTCACGCATCCACCGCCTCGAGGAGGTGC
AGAAATTTTATCACTATCCCGTTCTGAAATCATTTCTGAATATCGAGGTTCGAGTTGCATCCACAGTGGCGCTATTTCAGCGTACAATTGTGAACTGTAA
GGCATTTCAAAAATATTTCAGCAGTGATCACCAGGACGATGACCCAGTGTTTTTCAGGCGCTTAAATCAAATGACTGGAAATTGATCGTGGAAGTTGAGG
CGATATTGAGTTCTGTAGCGCATTTGGCATCGGTTGAGGTCCAAAGTGAACATTTGCTCTCTTCTGAAGCCATTGTTTTGGTGAAAGCCGCCCGCGACAC
GCTCACATCGACACAATTTTCGTGTTATGATTTGCTGGTGCAACGCTCTCCTAAGACAAAGGAATCTAACCTCCCCCGACCAACAAAACAGCTCAAAGAT
GTTTCAGACGGTTGGTGGTCATGCATCGTTCGCACACTTGGCCAACTCAAACAACGGAAACCAAATTTCACTAAGGAAATGATTatgccgcttcttctcg
atccCCGAACCAAGGGTGCTGCTCGTCTACAAGTTGCCAACGGCGGCGCAGACACAGAAaaagatgaagacgaagctctTTCCGAACAAAACAAACTTAA
CGATATTTTCGTGGAAGCGGAGCGGTTCCTTCTGGAAAAACATCGCGTCATCTATTAACGGATTCACTTGTGGATAAATGGGGAAAAGAACAATAATATC
AGCAGTGCTTCAAGCGTACCAGAGACGGGCACTGAAATGCGGTTTGACCTGCTGTAATCTAATTTGGTGCCTATCCAGACGGAGGCTGACGAATATGGTG
GGAATATAGGAGGGGAGCAGGCCGCAGATGAAGAACTTCGCAAATGGGGAGCTTTCATACCAAATTGGTTGTCCGTCGCCGTTAAGCAAAACCGGTTCGG
GCACGACAATCCGAAAGAGGTTCTTTCCCCACAATTGTCTGTGCACGTCAATGGCCGTGGATTTTGGAAGATTCACGAAGTTATTCACAACGTTGATATC
TGCCAATGGTTTCGTGACGAAGGCGCCAAGTTTTTCCCTTCCGTTGCGTTACTGGCGCGGATTTGGCTGGGAGGGAGCTCGACTACTACCTTTCAAGAAC
GCGTGTTTTCACCGGGTGGTATTGTCATGAGTAAGCTGCGCACGCGCACCGACAATGAGTGAGCTGATAAGCAGCTTTTGCTGAAGCACAACAGCCGGGA
GATCGAGAGGATCGAG