Description :
From Genome Similarity Track
Location :
Scaffold_8:77270- 79674
Sequence
2404 bases(100 bases per row)
GACCGATACGCGTTCGCTGACTCGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAGAGGAGTCCAGAGGGTACTGGAAACATCATTCGCCAGGTAAGTGGTTCCGTCAGG
CCAAGATCACTGGCAAGATCAACAATGAGAAGTCGATCTTATTCTTAGACACCGGCGCCGAGGTGTCCATCGTGGACGCCGCCTTTGCTCGTAAGGTGGG
GTGCTATGTCGACACGAGTCAGAGCCAGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGAGGAAGGAAGGACCAGGATCAAGGTTACGCTTGCGGGAT
CGCTGGTGTATTTCTTCGATATCTGGGTTGGCGATCTATCAGGACAAGAGGCGATCCTGGGTATGGACTTTATGGTTCCAGCGGGGATCCGTCTCGATCT
TGCGGACGGCTCTATCTGTCTCCCCGACGAAGTCAAGATCCAGCTTAGCGCACGGCGCCAGCTGTACAACGACAAGGTCAGACACGTGTGTGTAGATCAG
GGAATGATGATCGCTATCGGAGATTCGATTGAGCTTCCGCTACGAATGAAGGTGACGGATCGAGAAAAGCTATGGGTCACCCGTGGAGATCGTTGGGTGC
CGACTGTGGTCCGAGGACCCAGCAGGATCAGATATCGCCAGGTTACCAACATCAGCGACAATGACCTCGTCTTGCATCGGAATGAACGGATCGGGATGTG
GCTGGCTGGAGATCGGATACCCCGGATCCCAGGATATGTGTCGATCGGATCTCGTCGATACATGGAATGGCAGAATCTAGCCTTTCAAGCCACGACAGAT
GACCGGCCGACGAACCAGGAGGCACCAACGGGACCTCCAGTACCTGCCGTCGAGCGACCGATTTATCGAACGCCCCGAGACGCAAGGTATCCCCGATCGT
CGATCTGTCGACGGGTCCACCCGATCCAACAAGCGAACCGGAGGTAATGAGCCCTGATCCGGGGGCGACCGTCGTTGATACTCTTAGATCAGGGGGCAGA
CCGTTGCAGGACGATGATCGCGTGACAGAGGAGTCGGGGTCGTCTGCTTCAACTGTCCTCGTCGGAGATCCACCAGACCCACGGTCGGATCCTGTTGAGT
CGGTGTGTGAACCTTCCGGATCGGAGGAGGAATGCTCTCCAAAGCGGAAACAGGTGGGGCTGGACTCCCAGCCTTCGCCGATCACGGACCAAGCGTGTGC
ACCGATAGATGACGCGAAGCCGCAAGATTATCGTGCTGGCGACCAAGAGGGGAAGCCAGATCATGTGGATTTCGAGCTGAGAAGGGCGAAATCGTGTCCC
CTCACTAGCCATCGGCCGATCAGGTCGACGGTTGTGCCGTCGAACCAGATCTTGGGGGCGGGAGTACCGATCGGACACACCCGGTTGCGGTCTTAGCTGT
GGAAGAGTCGAGATCAAGTGACGATACAGCAGTCGACGGTGTTCCTGCATCTGAACGACTGCCGCAAGTGGCTGAATACTCATCGATCGTTGGGGTGATC
AGGTGGAAATGGAGGCCAAACCCACTTCAAATTGGGCGACCTCATTGCATCCGAACCGGATCGAGACGTTGGCGCTGATGATCAGGCCCATTACCACGAG
GGCGGGAATCGGTCAGCAGAAGATGTCGAAGGTTAATTAGCTGTGATTCCTGAAATTGTGATCTCGACGACGGATGAGGTGAAGATCGATGATATCAAGG
TGGGAGATCTGGAGTTCAACACCCCGGAGGAGTTCGATCGGCTGCGAAAGAAGATCTGGCACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCC
CCCAGCAGCCCGGGGTGTCACCTGCGACATCGACGTGGGCGACGCAAAGCCGATCGCTCAGTGTGTCCGGAAAGTGGCCCCCCGTTTGTGGAGAAGGTGT
CCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATCTCGATCACCGTGGGCCTCGCCGATCGTCGTGATCATCAAGAAGAACGGCGTGGA
TATCCGACTCGGCATCGATTATCGGCTCGTCAACAGTCTAACCAGGCTGATGGTATATCCGATGCCCTTGATCAACGATTTGCTGGAGGATCTAGACAAG
GTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGGTGACAATGACCGATCGAGCTCGTGCGGTCTCGGCCTTTATCACCCACATGGGTC
TGTT