Description :
From Genome Similarity Track
Location :
Scaffold_741:7727- 8730
Transcript NameFunction/comments
g4240.t1hypothetical protein
g4241.t1XP_009532708.1 hypothetical protein PHYSODRAFT_249081 [Phytophthora sojae

Sequence
1003 bases(100 bases per row)
AAGAGCTACGCGCACTCGTTCCATCAATGGACCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGGCAGGACACACACCAT
TCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCATCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACC
GGATAAGCACGCTGATACAAACAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTA
GACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTG
TCCAGCGTCGACAAGCCGTATTTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACTCCGGCAGGGGAAACAC
AAATGAATTTAAAATTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTC
ATTGGGCCATTCACCGTATTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTACACCCAACGTTTTACGTTGGGCGACTGA
AGCCGTACGTGCAACACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCGGAGAGCCTCGTCCCGACC
TCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGTTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGAC
GCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACT
CGC