Description :
From Genome Similarity Track
Location :
Scaffold_72:7725- 11495
Sequence
3770 bases(100 bases per row)
GAAAGGAGGGAGAAACCCTCCTTCTCTGGATTCGAGAAGTCGAAATGGGGATGAGCGCCGCTATGCTGCGAACCGAGCAGCAGAAAGTTGACCTAGATAT
ATCACAACTTGGCGGCAGAGCCAGAGAATGGGCTTTGACGTGTGATGCGTCTGTAGACGTCGCGTTTTCTACGTGGGATTTGCTTAAGAGGAAGATGTCT
CGCGTGTTCACACCCCCTAATCAGGCTTATCGGGTGCGTTCGCGCTTCTTATCCTCCCGACAAGGGAAGGAGGGATTGTCGGACTATGTTTAAGATTTGA
GAACTCTTCTTTCTGCTATGCATTTGGATCCCCTTCCTGAGGAAGTCCGTACCACTATTTTTATGGAAGGTCTCCGTACTGGAGTCGCTCGGACCTAACT
TTTTCATGTCCACTCCTCAACTTTTGAGGAGGCTGTGGGCATAGCGTTGAACGCCGAGTTTAATTTCGAAACAGCTCTCTATGGTACGCATGGACACGCC
CAATCTTCTCGTGATAGGGCAGAGCTCATGGATCTCAGTCATGCGGACGATGACGAAGCAGAACTTCAAGCTGTGGAACAGCAACGTAACATCCGTAGAT
GTTACACGTGCGGAAGCACAAGGCATCTCCGCCCCAACTGTCCATTGCGTAAACCACGACAAAATCGGCCGAGCCGTAATACCGCTTACGCCTGAAATAT
GGAACGGTGCGGGAAAATGTCGACTCGCACTAGGCGCAGGGCGCCCTACTGGGGAGGAAATAGGATTTGTAGAGGCTCTAGGAGGTATATCTGAACAGGG
CTTAGCCCCACACAATTTCGTGGACGTTGCCACGATATGTGAATACAAGTCAGGCTTGTTGGTTGCTTCGGCAACCATTAAGTGCTTTGAAGAGCCGTGG
TCAATTTGGATTGACTCTGGGGCATCGGGCAACTACGTCCGACACCGATCCTTTGAAGGAAGTCAGCAGTATTCTGAGGCACTAAAAGCGCATGAAGGTG
ATTATATCACGGTGCGTCTAGCAACGGGGGCCCGTGTCACCGCATCTAAAGTTCTGTAGAACTTAGGTGTAAAGTTTTATGACTTTATCAGCATTGAACG
CTGTCTTGTCCTGGATTTGGACTCTCATTCTCGGTATGTTCTGGCTGGAACGCCACGAGCCATGGATTAATTGGAGGTCCAAGACCTTTGGCGCAACGCG
CAATGTTTCTAGTGAAGCTCTGGAGAGGCATGAACACCCCTTTGCTATACAACAGAAGCGCTATTGGCGCAAGCCACAGATTGAGTCAATTAGTGTGATG
GACATCAGAATGTCTGAGTTAGTTGACTCTGAGATCGATGATATCATGTGAGACGGCACGTACTCCGTTGAGTGGCATTTGTTGTTACATTGAACCACTA
GATGCTGATAGCATTGATGACCCCAGGTCGAGTCATTTGGGGTGTGATCCCTTAGAGATATGTGCAGTGGCACGTGAACATCCACAGAGTGATGGCGGCT
TTCATAGAATCTCACTGAATGTCGATACTGGAGTTGTTGGCGAGACGCCCAGACATCAAGGGTATGATACAGTGGCGGATAACTCGCCGGGTGATGAGTT
CGAGTTACGTAACTCTGCACCGGATGTCGGTAATGACATCAGCTCTTGTTTAGAGTACTCTAAGGTTGACAAAGCTAATCACCTTGTAGGACCAGATAGT
CCGCCCTCGCTGAGGAGTTCAGTTTCTTTTCAGAGACGGCAGCGACGCCAAATGGCGGCTGCGCGATGAAAAGCGTGTTTAATGTCGCTTAGCGACACTA
GCAATCAGCTATATACATTGTTCGATGTCGTGACAGTTCACGTGGATGGTGAAGTTGGCCTTGCGGTCCTCCCATTGTTAACTCTGTTAGAGCTAGACGA
AATGTCTATAGACGAGTTTAGTCAGGCCTTGAAGGCAGGCGACTTATCCGATATGGTGGTCCTTAGACCCGATAATTAGTTCAACTCCTCGTCTCTATTG
GATGAGACGGTACTTGAAAGTACAAAGGCGGCATTTAGTGTACGAATTGGATCATCTATTTTGAAGAACCCTTCAGACCCCTACTACTCTTTGGTTAAGG
GATTTCAAGACGTGGTATGTCATAATCCACCGTCTGGATTACCTCCCGATAGGGGCTCACGTCATGAAATTGACTTGGTTCCTGAAACCAAATACTGCGT
TACAAGGCAGTGGGCCTTTGCCAAAGGAACAATGTGATGTCATTGACGATTTTTTCAGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGCAAGTCTCC
TCATTCCACACCAACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGTGTATCGTGCATGCTTACAATAAGCTTAATGCGGCCACTATACCAGCACAAACA
CGTTCTTCAGAACAACATGGCAGGATGTTCAATGTACAGTTCACTCGACCTGGTCGATGGTTATTATCAACTGCCAATGCGATCAAGTAATATCCCGCTT
ACAGCGGTTACTACTACAAACGGTATGCTTTCGGAGTGGCTGGTAAAGCCACAGGGGATTCCCAATGCCCAGCCTACGTTTAATTTTCTGGTGGCGCAAT
TGTCCCGCCCTCACCGTGCGTATTCACAAACATATTCGATTACATTTTGTCCATAGTCGGGCGATACAGGTTCCGTCAGATGTGGATAATCACATCGACC
ATTTACGAGCTGTGCTCGAGTGCATGCGCACTAATAAGCTCTATTCTAATGCATCTAAATGTATATTTGGTGCGGACGAGATCCCATTTTTGGGATGCTT
CATTGGGAAGCGAGGCCTTCGGGCAGATCGTGCAAAGTTAAAGGCCATAGTAGATGGCCAATTCCTAAAAACCAAAAGAACCTACGCAAATGGCTTGGCC
TTGCCAATTACTTGCGCAAGTATAGCGAGAATTACGCTGATATGGCTCAGCCATTACTCAATCTCCTTAAAAGGAGTGTGGAGTGGTGATGGAATAGCAC
TGAAGCAGAGGCTTTTAAGGCCGTAAAGGAGAGTCTTCTACATGCCCCGATTTTGGCTTTGCCAGATTCTGATCGGCCTTTCAGTGACGTCTGTTACGCT
TCGGATTTTTAACATTGGCTGTGATCTGTTACAAACAGATGTTGGAGAACGCGAGCGTGTCATCGCTTTTGAATCCCGCCAGCTACAAGCTGCTGAAAAG
AACTACCCAGTTCACGACAAAGAGCTACTTGCTATGAAGCATGTTTAATCAAGCTCAGAGTTCATCTGCTTGGATCTAAGCCTTTTTTAGTCTATACCAA
TCATGCGTCTTTACGCACGGCGACCCAATCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTTTCATTCTTTGCAGAATATAACTTCGACGTAAATTAT
AAGCCGGGAAAGAAAAATACGTTGGCTGATGCGCTGTCACGACGGCCCGACCATGAGCTTGCTCATGTTACGATTTTGTAGTCGTCAAATGCTGACTTGA
TCCGTGCATCCTATGCCAAGAATGAATAATGTGTAGCTCTGCTGCGTGCTCTTGGAAGCGATGAGGTTCAAGACTCGGACACTAAATTGTCGGCATGTTC
GCGTGCAAGGCTACATCGATGTTATATCGACAACGGATTGTTGTGCTATCGCACGGATACCTCGGATACCCCGCGTATCATTGTTCCACATGATAAAGAA
CTGAAGTATCGCATCCTCTATGAGGTGCACGACACCGCTATTAGCGGTCATCTCTGTAGTGAGAAGACCT