Description :
From Genome Similarity Track
Location :
Scaffold_1:772497- 781565
Transcript NameFunction/comments
Phyra_72806metallo-beta-lactamase family protein
Phyra_93356conserved oligomeric Golgi complex subunit 8 putativ
Phyra_93358zinc-binding region-containing protein, partial
Phyra_72809conserved unknown protein

Sequence
9068 bases(100 bases per row)
ACCGAGGCGCACAAGATTCGCCACCGTACACGTATTTGAGCTTGCTAGGGGTGATCGGAAAGATCAAGACCATTCGACCGAAGCTCACACTGCCCACTGC
TGAGCCACGAACGCGACTACTATTCGCACAGTGATCGTAGCGCAAAGAAGAGCTTGCGCGTCGCCATGGCTTACAGTATCGACGGATTGCGGCTGACATT
CGACTATCAAACACAGCACGACATCACTTGCACGAGCGCCTGCAGCACAAAGAGGACACTTGTTATACGTACTATACCTAGTCAATTTTTCTACTCTCGA
CGAAGGAACTTGCCAAGCGTGCAATGTCGGAAAGGAGTGCTCGAACAAAGTCTGTTACAGCTAGCTCGCGAGATCGTTCATAACGTCCTGGTAACGGACA
AGTTTTATGCACGAGGAGGGGCATTCTCAGCGAGCTCTTCAGCCAGTCTCACTTCTGCGTCAGCGCAGGTCCCTCGACAAGCTCCTTCTCGTCCCAAGAT
GGAAGTGGTGGTGCTCGGCTGCGGGCCGTCGTCGTCGGTGCCGTCCATGCGCTGCGTGTTGAGTCAGAACTGCGCCGTGTGTCTCGAGGCGCACACCAAC
CCGGATTCCAAAAACCGTCGACTGAACCCGAGTCTGCTGGTGCGGAACCTGAAAACGGACACCAATGTGCTCATTGACTGTGGCAAGACGTTCCGCGAGG
CGGCACTGCGGATCTTCCCCAACGTCGGCGTCTCGGCGGTTCACGCGCTAGTTCTGACCCATGACCACGCGGACGCACTGCTGGGCATGGACGACCTGCG
CGAAGTTCAAGCCCATGTAGAGACGGTTGACCCCGTGACGAAGGAGCTGTACAAGATCCCACCGGAGGCCATGAAGGTGCACTGCAGCGAGCCCACGAGT
CATGATGTAATCGCCAAGTTTCCGTACTTGATTGACAACGAACCCCCTTTCCCGACTGGTGAGACTGCGCCGAAACCATTTCGTTGGACCGCCAAGCTTC
AAATTGACGCTTTCAACGCCTGGGAGCCGTTCGAGGCCTGTGGCATGAAGTTCCTTCCTTTCCCAGTGATCCATGGCGCGGGGTACACGTCGTTCGGCTT
TGAATTTGGCTACGAAGTCGGTGCAAGGTTCGTCTACATCTCAGACGTGAGCGAAATCCCAGAAGACACCCGGACGTTCCTCAACGATGATAGCAAACCC
CCCATCGATGTGCTGCTGATCGACGCGTTGTACCTAGAGAAATATCACAGCACGCACATGAACGTGCAGAAAGTGATGGAGGAAATCGCCACCATCCACC
CGAAGCGTACGCTGCTGACAGGAATGAGCCACGACTTCGACTACCCGAAGCACAGCGTCGAATTACCGAAAATGGGCGACGAGAAGGGTCTGAACATCGA
AATGACCTACGACGGACTGCGTATTGCTTTCTCTTGATCATGTTACACAATCAATATACTCGAGGAGCGATACTTTGCGGTGTCATGGGGCCAGCCATGC
TATCATCACGGAATTTGTGTCACGAATAGCGCAAAACTTCCTATTTCATCTTTCTGTTGTGTTTCTCAAGTGAGATTAATCCTCTTCATGATCAAAGGTT
GACTTGTCGGCACGCTATCGATCCCTTTAAACCAAGGGGCTTCAACGTGGTCTCACTTTGACTTTTGCATTCAACCTCGCAGACATCTGTCGTGATACTT
GGCTGCGGGACTTCATCGTCCGCGCCATCTATGCGTTGCAAGTGCTGCGATGTCTGCCGAGAAGCTCAAGCGAATCCAGGCTCCAAGAACCGCCGTCTTA
ACCCCAGTCTACTCGTTCGCCACCTTGAAACCATCGCTAGCGTACTCGTCGACTGCGGCAAAACGTTCAGGGAAACAGCTCTGCGGATCATCCCTAAGAT
CGGCGTCTCCGCTGTCCACTCACCCACAACCACGCAGACGCTTGTCTGGGCATGGACGACTTACGTGAGGTGCAACCTATAGTGGAGATCCTGGATCCGA
TCGCGAACGAGGTGTGCAAGATTCCTCCGGAGTCTATGAAAGTGCACTGCTGTCAAGACACAAGTCGAGGTGACATTGCAAAGTTCCCATACTTGATGGA
AAATACGACTGAAGCTCAACCAAGAAACATTTTCGTTGGACGGCCAAACTTCGACTGGAAGTTGTTGAGCCATGAGAACCATTCAACGCTTGTGGCATGG
AGCTTCTTCCCATTCCAGTGATCCACGGGATTGGCTACACTTCATTCGATGAGCTCGGTGCAACGTTCGTTTACATTTATGAGTTTCCAGTGAAGACTCG
AGCGTACCTCAACGACGCCAGCAAATCACGTATCGACATAGTGATGATTGACGCGCTGTATTTGGACAAGTGCAATAGTGCACACGAACTTAATTCAAGC
GCTCAAGAAGATCGAGACAATTTGCCCAAAGCGTACGCTTCTCACTGGCATGAGCCACGAATTGGATTACTTCTCCTATGACAAGTTAGTGAAGCAGATT
CGTAACGAGAAGGGTCTCAGCATCGAAATGCCCTGCGATGGATTGCGTTTTGCGTTTCCTTGAGCAAAGTTAATGACAGTCTTGCTCCAATGTTCTCAGG
CTCGCTTGAGGTTGCCAACCTGTAGTGCGTCTATCCAATCATTTCGGTGAGTGGAGCATCAGCATCAGTGGCTATTGGCTCCAACGCTTCACTATTCAAG
CCAACCTCATTCTTGGTTTCCGTAGCGGTAGATGGTGGGGGAAAAAACAAGCCTGCTTCACGCATGATCTCGTCAAAGCCTTCTATTTCCTTGCTCACGA
CACTCGCGGCACTGAGAGCAGCGGCCGACGGGACAGGGAAGAGACGATGAAAGCATTTGATAAGGTATGGCACGAGATCCGCGCGAATAACCTGCACGCA
CCCCCACAGTTAGATTTTTTCAATTAACTATAAGTGATTTACATGCAGTTGATATCCGTACCTCATTCATTGCACGAACTGAGTCAGTAAGAGCCGCTGA
CCTGGCATTTCTCGGAGTCGTGGTTGAGTTATCAGAATTGTTTTCACCAGCCGGGGAGTGCAAGTCCAGCCCGTTTTCCTCCACAAAATCAGCAATCGTG
AGCAACATCGTTCCAATCGCACTTTGGTACTTCTTTCCAAGACGATTCTGCAGCGATGAGATTGAGCACAGTCTCAATTCGTTGAGCGAAGATAGCAGCG
CATTAGTAAACTCAGCCAGCAGCGGGAACGACATCAGGCACCGCGGGGGTGAATAATCTTCTCCATCAGACAAGGTAGCAGATACACGCGAGGCAAAAGG
GAAGTTGCTACCACCTCCATTCGCAGAAGAACGGTACGATGCGATCACAATGGGTGTCTTTGAGGATGCCGAGAACGAAGAACCGCTCGACGCTGATACT
GAGTGTGCATTCAGATTCTCTTGGAACTCACGACAAGCTGATCTCCAGTACTCTGTCATCAAATTCAGCACGTGATCCTCAAAGTACACGACGAGCACAG
CACGAAAGTCTACGCCAACACGACCCAACGACCCTCCAAAGAACAGACTCTGCTCTAGAATTGTCGCGATTGAGCTAAAATCATCGATCTTCGGAAGTTG
CCTGCACCCAGCAGAAAACAGTCCAACAAAAATCAGCTCGTGATACCACAAAAGTACAGCACGCACAAGAGCTTGATTGCGTACTTCATGAGAATGTGGA
TGAAGTTTGCGACTGTCGTCGTCGCCCAGCGACAGAGCGGTGGGTCCACTTTGCCGGCAACATTCTATCATGAATGAGACGGTGATGAGTCGTGACCATT
TTCTAAGGGTCGTAGCAATAGTGAGACGGCGAGGGAAAAGGTTGACTTACCTCACTGCCGAAGATCGCCGAATACTGAGTAATCATGTCAAACCAACTCG
TTCTCTTGATGTCGATAACTTGGATAATCTGCACGTAGTAATACAGTAATCAGCGAAGTGCACCACCCAGTCTCCCATATTGACCACGGTGGCAGACATA
CATATTGATACGGTTCAGAAGTCGAAATGCCTCGACTCAAGGTCGACAACCACACATTCCTGCAGGAGAGGAACTCCTCCTTGAGCTGCTTCTCGTACTC
TAACGACCCCACAGCTGCCGCTGCATTTCTTTCAATAAGAGCATCAAGACGTCGCAGATACCCTACAACCCGTACACACAGCGCCAACTGCAGATCCTCG
CGCAGCTTTTGGAGCAATTTTTCGCGCATGATGCTGGTCATCTCCGCCACCTCCCGCACCAGACAGTCAATCACCACGTTGCGTGAAGCTTCAGCATTTT
CGTCCGCTTGGAACGTCTCATTGGCGAACTGAATCGCATCCAGCGCCGAGTCAAACAACTCGTTGTGAATGCACGCCTCCAGAAGCTGAGGGATCTCCAG
CAGCTCCGTTAGCTGCCCAACCCATGTACAATAATTGTATTATTAGCAACTTGCAATAATTGACAATAATTGCGCATGGCGACGAACCTGCAAGTAGTGC
TCAAAGACAAACTGGATGTCGCCGTGCTTGGCCACCACGTCTGCCACCTCCTTCTGGAAGTTGGAGCAATATCCCTGAAGCTCCGGGATGGCCGCTTCGA
TCTTGGTGGTCTCCTCCTTGAGCGCCGCTAGCTGTAGAGCACAACATACAGTTATTGTATTGGAAATGAGTGGAAAATGTAGTGGATTCGCTTTGTTTGT
TGAACGCACGTCATCCTTGACGATGGCTGCGCACTGGTTGCTCTGGATGAAGACGTGGTAGTTCTTGAGCACGAGATTGCGCAACTGCTCCGCCGTGTTG
TCCGCCTGGATCTGCAGGCGCCACGGCTCCTTCTTGAGCTCCTCGAGCGAGCACGTCTGGAGCGACGCCAGCATCGCAATGAAGAAATCGGCTTTGAGGG
GATTGTGTACGAGACACCATCGGCTCACCTTGCAGCCATTGCTTTGACGCCGCGAATTACTCGGCCTGCAACCGCGTTCCGGCGATTCTCACAGATATAA
TCTCTTCGTGTGAGCTTTGTTCCCAATTCTAGCTACGACAATCTTGGTTGGCGGTAGCACTGAAGCCAATGCAGGCTTTTGACGCCTACTAGTACGCGCG
AATGTCTTCGCGAATCGACCGTGTCACACCAAGTGTCGTTGCAGAGTTATGACCACCTCTTGGCCTCAGATTAGAGCTGATGATGGTATGCGCGGCAATA
TGGACTTGGACGGGGCCTGGCGTGGAGAAAGTTGCCACGGCTGGCAAACCGTGGTTTTACAAGATTGAGTGTTGTGGGATGCATGTGTACCTGCATCGAC
AGAGCATCCGGCATTCGAGCAAGCAACGCCTCAAGCAACAGCGTCTTGGTGCTGTATGGAAAGGCACTCAAGCACGATCTTCTGGTGCAACAGGTTGAAG
CAAAAGTTCAACTTTTTGCCCTAGCCCTCGTTTTACGTGTCACTTTCAACCATACTGAAGCCCAGATTGCGAGTTCAGCAACCTTATCTGGCGATCTCCA
GCGGCTTGAAACGCAACAACAGTCGTTATTTCCTCGGGGCTGGGCAGGAAGGAGTGTGTAGCCTCGCCGTCGTCACGCTCGCGGCTGCGCGGCCAATTTC
CCAATCGTGGCGAGATCCCCACAATCGATTTCGCCCCGAAAGCAGCAGACCGCGCTCCTCCCCACCCCGTACCACAATGCTGACCCGCAACATCTCAGTG
GCCTCGCGCTCCTTGGCCTCTATCAGCCGCCGCCACTTTGCTGCCACAGCGGCTTCCACTAACGCCAAGCGCGTGAACGGAGCTCAAGGCCATGAAGCCA
TGCAGCAAGGCCAGTTAACCTACGTTCCCCTGGGCTCTGACGGCCGTTTCTACATCGAGCAGCTGTAAGACGGATCCTATGATACTCGCCCAATACACGT
ACCACAGGCAGCTCTTATTGACATGTTGTGGCTGTGCATTTCAACAGGAACGAACACTGGCGCTCGGCAGTGGCAGGCCAGAACTTCAAGGGGGACGATG
TCATCGGCTCGGCTCCTGGTAACTTGGTATGGCGCGAAATAAGATGCTGATTGATACGATAAGCTGTGATGACTCACTCCAGTGTGGTATCTTGGCTGTT
ACAGTACACAAAGGCGACTCGGTTCACGGTGCAGATCACGCCACACAAGCACATGGACTTCACGGGCGGACTGGAGTTCGTGAACCATAGTTGCAACCCC
AACACGCGCATCGACATGGCTGAGAACGAGGCCAAGGTCTCGTTCGTGGCCATCAAGCCGATCTCCAAGGGCGAGCACCTGACCTTTGACTACTCCACAA
GCGAGTGGGACATGGACGAGAAGTTCGATTGCCGTTGCGGCGCTCCGAACTGCCGCGGACACATCGGCGGCGCCAAGTACCTCAACGACGACGAAGTGAA
CGCGCGTTTGCCGTACTTCACCTCGAGTGTGTTGCGCCAGTTGCTGGACCGCAAGCTTAGCAACTAACATTAATTTTAAGTTGAAGCGAGTTGGCCCCGC
CCAAAGCGCTACGGTATTTCTCGATGTTGCCATAAGCTTAGCTTCTGATGTGTTCCATCAAAACTTGTAAAACCCTGATGACGACGCAAAAGCACTACAA
AGGTTGTCATAACGATGACGGCTAATGTAGTTTTTTACGATCGTGTGGTGCTGGGAGGATACGTTTCAGGGTTAGCTGCTAGCGCTGTCTTCCACTGCTC
AAGCGTGTCGATCACGCCAGTGAACACCTGCTTGTCTTCAAGGCGCACCCGAACAGCAAATGACAGTCGTGGGTTTGACTCGGTCTCCGATTCTGCCAAA
ATTGCCTCGTCCTCCTCGAGTCTGTATTGTTTCAGTTGCATCAGTAAAAATAATCAATACGTTAGAATAATAACGCAGCCACTAAGGCGGGAAATATTAA
TGCACGTACGTCGTCGGGTAGTTAGCCAACTTTCGGCGGCACGTGTTCTGCAAGTTTTCATACACTGCCAATTCGTTGCGAATGCTGAGAATGGATGACT
CAAATGCCTGTTAGAAAGAAAGAAAAAACGACAAAAATACTGATCAGATCTCGATTACGTCGATCGGTGATATGCATACCTTCTTGTACTGGCGAATTTC
TTGCTCATTCATCAAGATCACTCGCAGAGTGGCCAGCAAGCGCTCGTCGACATTATTTCTGGAAAGGGTCCCACAGAAATCGTACGTCTGCTGATTGGTG
AGCTTGTTCGAGTCGAGAACAGTCTGTTTCAGCTTCAGGTAAGGATCGGTGGGCGGAATCTTCATCCAAAAGTCCACTGCTCGACGAGAGTTTTCCTGGG
CAACAAACCCATACGAATACAGCAGCTTCGCATTCGAGTATTGACCGTAACTGATTTGCAATGAACATCCGGCCGCCATGCTCTTTGATACATGTTGTGT
CATCATCTGGTTCTCCTCATCGAACGAAATAAAATCGTCCAGTGGGTTCAACAAGCTCACATCGTGATTAAACATATCCATCGCTGGACACAGCACGCGA
AAGTAGGTCTGGCCCTTGCTCACACCAAATGCTCGACTCCAAATAACGCTCATAGCCCACATGTAATCTTCAAGTGTCAGCGTGGGCAGTGACGCGAAAA
CCTCTGGGAAATCCTCCGCCACAGCTTGGTGAATGTCCCCAAAGTCCCTTTCGAGATGCTGCTTCATCAGTTGAGTAAGTAGAAGCACATTCGTTCCTTT
GAGCTCGTTCAGCTCTTGTTCCGACCAAAAGGCAGGCAAGTCGAACGTGGTCGGCAGTGATGCAATGAACGGCGCGAAGAACGAGTCTTTGCCCTTGCTG
CGCTCGTGCATCAAGTGCAGCGCCAGCACCTCGTCCGCAGGGATCTGTGGGTATTTCTGCAGCACGGGTGCAAGATCTGATTGGGCCGCCGACTCGGTGT
TCATGGTCAGCTTGAATGGCACTTGGAGCGTCACTTGACCGCTCTGGAGCAGCTGCTTGGCGAACACGCCGTGGCCTTCGAGCTTACCCAGGTATCGAAT
GTCCAGTAAGCTGTCAGTGACTCCATGGGCCTCGAGCCACTCCAGCAACGCCGTCACGACAACAGGAGAGCTCATTTCAAAGTGGCTGGATGTGAAATCG
ATATCATTTTCTACAGTTCGCATAGACCTATAAATTATCAGAAGATTCCGGTGGTCGCAAGCGCGTCAGCAAGTGTTCTCACGGCAGGCCGGCGCCACTC
AACAGGTCGCTGAGTATCATGCCTGTGATCCTCTGCTGCAGCTCTTGATCTTGCTGGATCTGCAGTGAGGACAGGATGGAGGTGCTCTTGGCGCGGGAGA
TTGGCGTACGTGGCAACAGTCCCGACTGAGGGGGACGGGCTGCAGTGGAGAGCGCCTCAGTTGTCCGGCTGAGCTCCGATTGAACTCTGGATACGATGCT
GCTCACGTTGGACGCCACGCAGTTCTGTGACAGCAGTATATCCCCGGTGAGCCCACCATCGGTCTCTGAATCGTCTGAAAGCAACTTCAGTTGCCGCTCT
AGCTCGCGCTCGGACTGCTCTCGGATCGCTAGTAATTCATCAACTTCAGCTTGGATGTGTCGATAAATCACTGCGAGCACCGAGGCGTCATCGAGAGTGG
ATGAAGATTGTTGAGTCGAGCTGAAGCAATTACGAGCGACATCTTCAATAGTCTTGAAGAGAGCACGCGCTGTGGATGAAGCTCCTCCGACCTCGAAAGT
GTCAAACCTCGGAAGCCGGATCTGTTCACATTTATTGACGAGTAAGTTAGCAAAAAAGTAACCATCCGATGTGGTAAATTTGGCGTCACCAAACGTACCT
CTCCATTTACGATTTCAAGCTTTCCCGTAATGCGATCCACTAGGTCACGATCCCTTACTCTTGGGTCCTGGATGGATGCGTGCCTCGCTGACCCTTGAGG
CAGTTTGACTGGAGGAGAAGGTCCAATAGATTTAGCAGCGTATTGTGGACTGCTCTTAGCTGGGTCTGCGGGTTCTTGGAGAGACCAAAGGCGTAGCTCC
GAGCTCAAGGTTTCATCGAAGATAATGGTAAAGATGGCATCCCCCAAACGCTCGCTCTGCATTACCTT