Description :
From Genome Similarity Track
Location :
Scaffold_34:77246- 78415
Transcript NameFunction/comments
Phyke_g1974hypothetical protein

Sequence
1169 bases(100 bases per row)
CGGAGCGAGAAATCGAAGATTGCCGGATAGGTGATTCCGTAATGTTTGCAGAGACTTGCTTTTGCGACTCCGATGCTGTATGATTTGGAGGGCATTCGTA
GATTTGTGGTCTATCAAATGCTTCAGATACACTCTCCTGGTGGCCATCACCAGAATTCGCCAGAGTAGCCTCTTCGAACAGCCGGCGCGAAATTGAACCA
TCTTGACGTTGAGAAATGCCAGTACGCGCGACGACACCTTTGGCGTAGCTGTCTTCATCTCGTACCGCGCTACCTTGATGGTTGCGCGGCTTAGGTGGAG
GGGTAGTGACATGAATCTCGATGCTGTCGTTTAGTTTTCGCCGAGGAGAGTTCAGGTATTTTGAACGCCGCTTTGCGAAAACGGTTCTGCTGTGAGAAAG
CATTTCTGTTTTGTTGACCAACTCAGGATATTTCTTCAGAATTGCCGCAGACAACGACGAGTCCGGATGTTCACTGATAAGCAACATCTTGGACTGATTC
GATGGCATATCCAGCAACTCATAAACGCGTTCACTCCTTTTACgaccacacacagcaacCAAGCACAGCACACATCAGCTATTCAAGTAATtgtaacagc
agcaacaacagcatggGTAAAACAAATCCACATAGTTCGTACCATCGTGTCAAAAACCGCGTCAGTGTTTCACGGGCAGTCTTCCTCACCTTGTCGCTCT
GGTCCTCCAAGCCTCGTCGAATCATCTCCAGCACATCTGAGTCCCACATCTCCACTTCGTCGTCCGACCAAAACACAAAGATGATCATCAACTGATCCAA
CAAGAGTATCCGGACTTTTTCTATTAAAAAGGACAAAAATACCCAATTATGTCAGAGCCGACAAAACACTCGATATCGTAGCCAACAGTTTGCATAAAGG
ATTACCTTGTGTAAACTGCAGGAAGATCTTCTTCATAAGCGACAGATCATAGCGCACCATCTCCGACACCTTGCCGAGCAGCCTAGCTCCTGGCTGTCTC
ACAGCAAACGACGAGTTCCTGGCCGTCTGCACAATTTGTGGCAGTAGTGCATTGGCCAGCTCCTGAAAATCCGTCCCCGTCTCCTTGACGATCCTTAGCA
GCTGTTCACACACGTCCTTGACCAATTTGGACCGAATAGATGTCAATTGAACTCCAATTTCCCCCTAAA