Description :
From Genome Similarity Track
Location :
Scaffold_11:7724- 9083
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005163Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)

Sequence
1359 bases(100 bases per row)
CAGCAGTGGCATTGTAGTAAATCTCACGCTCATCTTTGGGGTGGCAGAACGGGAAAAGGATTTTCGGGTCCGAGTCGTCTGGGTCGATGATGTTCTTTCC
AGAAGTGTAGGTCACATAGCACCCAAAAACAAGGCAGACGATGATGACAACAATCGCTGCAATCTTCTCATATGCCGGAATATTCGTCCAGAGCTTCTTC
AAGTAGAACGTGATTGGCAAGATGATACAACTCATTGTCATGCACGACGCGCCGATGAAGTCGTTGAGGTCCAAGAAGTGATCTCTCAAGAAGACCGATG
ATATCACTTGAATGCAAACGATGCAAGTGCGGAGCAAGGCGTACTTCCATGCGAAGGCACCCGTGTATTCAGCGGCTTCGATCTCTTCATCCAGACTTTC
TTTTTCAATATCAGCGATAGAGACCACCGAGTTCTTTGACGTGCGAGACTTCGATTCAGCTGGAGTGTTGATGGACTCGTAGCTACGAGCTTGGAGATCG
TCATCTCTCTTTTGGTGCATTCCCAACACCAGCCGCTCAGCAATGTAGAATGCTGGCGAGACAATGACGGCGAAAGCGATCGTGATGTGCAACTGCATGC
ACAAGTACGCCAGTACGACCATGCCCTTGTTCGATGTAAAACCCAGCTTGCTTAATCCAGTAACTGGATCTGGGAAAATAGTGAAGAGCAAGTTGCCCGA
GATCTGGCAACCGACGGCAGAGTAACCCGACCCGGCGAGCGCCAAGAACAGAACGGAGATGAAGGTCAGCGTGACACCGACAATGCGAGGCATGCGCGTC
GGGTCGCTGTGCTGGCGTTGCAGAGCAGGAATTACAATCGTAGCACCATAAGCAAGCGATAAATTACCGAACGTCGTCGCAACTTGCTTGAACGAGATAT
CAGGAGTTGGTACCGATGGGTGACCGCTCATGCCGTGCAGCAAGACAGCAACACCGATGACATCCGCGATAAGCGTACCCACACAGCCAGCAAATGCAGC
TCCAGCTCCTTCCTTGAGAGTTGGAGTCAAGCAAACTGGCATAACGGCGACCGCCATGAGGATAATCCACGTTGACGACTCAAAAGTATCCGGAAAGAGA
CTTTGCAACAGAGTTCCGCCCAGTACCAAAAACGCGCACGGCACCAACAGACAAACACCCATCTGTGAAGTGACGACGAGGTACCGCCCAGTCTTGCCCA
TGCACCATTCGCCGAGATCACCAAACGTCTTGACTCTGTTCGGAGCCGCAAGCATGACCTTGGAGCAGGCTACACCGGAGTAAATGTTGGCAAATGCCAT
AAAGATCAACGCGAACGTGGCGATCACTGGTCCAGCTCGGGAGAAGTTAGCTGGCATGC