Description :
From Genome Similarity Track
Location :
Scaffold_1809:772- 3682
Transcript NameFunction/comments
Phypl_g14189hypothetical protein PHYSODRAFT_322011

Sequence
2910 bases(100 bases per row)
TACTATTGAATTTACTACTTTCGCGGTTGGAATCGAATCTTCAAAGGGCGCGCACGCATGTGCGATCTTGGCTTCATTCTGCCCTCTATCCCTCATTTCT
AGACTTCCCCCTTCGAACCACAACCAAATGAAGTGCGCGAAGAGTGGCTGTTCCTGGAGTACCTTGGAGGCGATGTCTCCTTGCAGTGTTTGCGCTCGTC
CGGTGCATCACTTGTGCAGTAACGAGCTCTGCACCAAGGCAGAACTCTCAAAAAGGTAATGCTGCTCGTTTCAAGTGTATCGGTTAATGCTAACACGAGC
GTTCAGGTTCTGCAGTCTCAAGTGTGTAAAGAAGTATTGGTGCTGCCTGCGAGCTGAACTCCGAAAGTATTGGTTCTTCCAGCGAGTTGACGCTGAACAG
CATGTTGGGCACGCCAAGCAGTACGTCAGGAATGTCGGCCTCAAGCCAGGTTACGCTGCTTGACCTCCGgaatgaagacgaagaggagaaggcggaggcT
ACGAACGCCATCCCAGAAGAGATCGACCACAGCCAGGCGAACGACTTCATCTGGCAGATGGTTCACAtgctcgacaagaaggtATCGCACAAAGGCAAAG
AGTTCACCCACATTTGCCTCGAATGCTTGAAGGCGAAAACATGGAAAGAGTCGCTCTGCAATGCTGGAAATACGACGAACGCCAAATCGCACTTGGTGTC
CGCTCACAAAGACCACCCGGAGGCAGCCAAGGAAAAGGAACGTCGGCTAAACTGAGCGACTCGCTTTACGGTGAAGATGAATACGGTGGATAAAAACGAC
GGGAAGCGCAAACGCACTAGTGAGTCAAAAGCACCAGGTGCCAAGCAAGAGCCATATCACGTTTTGGACACCGCAAGTTAATCAAGACAAAACCACGGCC
CACGTAGCTCGATGGTTGATTCGGGACGGTGAGTCGTTTGACTATTGCATGTAGGTTACTGACGTATTCTTTTTCTAGGCTTGCCTTATAACATGATCAC
CACGCCGGCTTTCCGTGAGCTCCTGGCAGGCATTACCGCAAACCCAAATGTGACCGTACCCTCGCACAAGACTTACAATGACATCCTGGACAAAAGTTAC
GACTCTTTCCAGACGGACACGAAAGAACTACTGGCGAAAGAGTTCAAGGAGCTTCACGAGACACCGTTTCTCACTGTGGAACACGATCTGTGCACAAACA
AATCCAAGAACACTATTGTCGGTGCTTCGTGTGGGTTTATCGACCATCAGTGGAAATCGCGCAAGCTTGCCCTTCTCGCCCAGGTCAAAAATGATGGTCA
CGAGTCAGAGGGAGTAGCAGGTCTGCTGGATGATGAATTGAAACGGAGGTACGGGTTAGACGTAGAGAAAATGGCTCGCTTCACAATATCGGACACAGCG
TCCGCAGCGCGTAAGGTGTCAAAGCAGTTCGACTCGACCTTGTAAACCGATTGTGCGATGCACGCACTCAATCTCTGTATCGGGTACGAGATTGGCTTGA
AAGAGAATGTGCGGAGTAAGTACATACCAGACCCAACAGGCAAAGAATCCGGAGCGTTCACAAAGCGGAAGGTTGTGGTAACTGACGGGGGTGCCTTCCC
TGAAGGTGGCGCTATTATCCGAAAATTGCGCGCGTTGAACAATTTTTTTGCGTCCAGTCGATCTCCCGAACGCATCGAAAAGCTCAAAGAAGTGCAAACA
TTCTACAAGGTACCTCTACTGGCTGCTATGGTGGATATCGACGTACGTGTGGCATCGACGGTCAAGTTGTTCAGGCGCTCTATCATCAACTATCCAGCAT
TCAACGCATTTTTTCAGAGGGCTGACTTATcgaaggcggagaagaaAGTATTCACCAGTATCACAGCTGCGGAATGGGAGTTGGTGGTACAACTTGAAGC
GGTCGTGCAGCAGATAGCTGACCTCGCCCTAGCTGAGTGGCAGTCGTCTACTATGCTATCATCCACGATGTACGTCTTGCTTCGCGTGGCTGCTTTTCGG
ATGAGTTCTTACAAGTTTTTGGCGTATTCACTGAATGGAACCCGCAATGCTGACACTAACGAGAAGAATTTTGCCCGCCATGAACTCACACGACCGGACT
TGAGTGAGTTGGCCCAACGATGTATCAAGCGGACTTTTCATCAGATAGCTGCCCGACTTCCTCAGCCCTCAGTGCCGATGGGTATGGCCCTGTTGTTGAA
TCCACGAACGAAACGGGCTGCTAAAAATTACCTACACGTACCCGATCGCGCAGGAGGAGTCACTGACCGCATTTTGGAGAACACGAAAGAGTTGCTGCGA
ATTGAGCACAGAGTGTTCTATAAGGCTTTGCACGGTAACGATGACCCCGGCGAAGAAACGGTGACTTCTGCAGCGAGCTCACCGCGCGGAGAATCTAATA
GCAACTCGGACTCGGAGTTAGACCTTTTGTGTGGGGAAGAAATTTCGCAGCCAGCCGACGATACCCCAGCTGACATTTCGTTAAATGCAAAGGCGGGTGC
TCTGTTGGAGCAGTGGCTGGACCTACGTATTAATTGGGAGGAAGTGGTGCGGCATCAAATTCCGGATAAAGTGGAGTGTAACAGGGCTCTATCTCAGCTG
ACCATGCTCAACAAGAAACTTGGAAATGTCCGAGTGTGGAACGTGGAGCGGCTTTGTCGGGAGGTTGATGTGTGTCGATGGTTTGCTGAGTATGGGCAAG
CCAGGTTTCCTTCTGTGGCGAAACTTGCGCGCGCCTGGCTGGGACGAAGTTGTTCCACTGCGTTCCAAGACCCCGTATTTTCGACTGCGACGCTCGTCAT
GAGCTCACTCCGTACTCGCACAGACAACGAGCGAGCTCAACGGCAGCTAGTAATGCGCCACAATCGCGATGAACTCAGACGCATGGAGGAAAGCAAGCAC
CGCATTTGGT