Description :
From Genome Similarity Track
Location :
Scaffold_1619:772- 2356
Sequence
1584 bases(100 bases per row)
GAGGCTATTCACGTAGAAGGGAGTAAAGCCAGTCCAGGCATGGACAACGTTGTTCAACAAAAAATCAATGACAGGGAGCATCGAGCTCCAAGTCCATGGC
GACTAAGAACAAACACTGCGAAGAACATCACCGGTGACGCGATTAACTCGCTCAGTTTAGCCATCGGTGTGTGGATGGATGATCCATTGTGGACATGCCC
AATCGCGTGCCAAGCACCTTGAAATTGGAAGTCCAAAACTTGCCGGTGAAGCGAGGGTCGCGATCAGAGATGATTGCCAGTGGCAACCCTAGTTGACGAA
ATACACGATCGATATAAAGCATAGCTTTACCTTTGCCATCGATCGAATATGGCACTGCCGCTAAGTAAGCCATTTTGCTTAAACGGTCAACAAAGACCAC
AATTTCCGTATTGCCGTCACAGTCTTTGGGAAGACCGAAACCAAATCCATACTGATGGACTTCCAACACCCCGTGGGCACAGGTAATCTGGCGAGTGGCG
CAGCCGAATGTGCCGAGGGTTTGACCCTCTGGCGAGTGGCGCAGCCGAATGTGCCGAGGGTTTGACCCTCTGGCACGTTTCGCATGTACGCACGTATGTG
CTCACCCATTTGTAGAGTTTGGGCCACCAGTAGTGTTGACTCACAGAGCCATAGGTCTTTTCCCGGCCCAAATGCCCACTGATGGCAGTATCGTGGGCCT
CAAAGAGGATTCGATGTTTTAGATCCTCATTGTGAGGCACAACAATGCGAGCGGTATCCGATACATCTGTGCGATAGCACAAGAGGACATTATCGATGGA
ATATCGATTTAGGCTGGCCCGCAAGCGTGCCGATAACTGACTGTCCAAGTCTTTGTATTCCTCACCCTCAAGGGCATGAAACAATGCCACACACTGAGTG
TCCCGTGGATATGCCACGCGAATTAACTTCTCAATAGGAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTTGGCGAGAGAGGGCATCTGCCA
ACACATTTTGTTTGCCTGGCTTGTACTTCAACTCGAAGTTATATTCCGCAAAGAAGCAAAGCCACCGAGCCATTCTATGAGAGAGGTGAGGTGACTGTGT
CGCTGTGCGTAATGACGCATGATCCGTATAGACGACGAATGGCTTGGATCCAAGAAGATGGACTCTAAATCTGACGAGCGCATACTTCATAGCAAGTAGC
TCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGATTTAAATGCGATGACTCGCTCGCGCCCTGCAGCATCTGTTTGTAACAGAG
CGCTGCCTATAGCAAAGTCGGATGCATCGCAGCCAACACAAAAAAGGGTACTCAGGATTTGGCAACGCCAAGATGGGAGCATGGATGGATGAGACTCTCC
TTGATTGATCGAAATGCGTCAGCATGTGTGTTTTCCCAGCGCCCATCTATGTCGTTCTTAAGGATATCAGTTAATGGCCAAGCCATACAGCGCAATTTTT
ACTTTATTTGTGTAAGTAATTGGCAAGACCAAGCCACTTACGCAAGTCCTTTTGATTCTTAGGAATCGGCCAGTCCACTATAGC