Description :
From Genome Similarity Track
Location :
Scaffold_435:772- 1944
Transcript NameFunction/comments
Phyke_g9464conserved hypothetical protein

Sequence
1172 bases(100 bases per row)
TCCCGTTGGCGTCAGTTCGTGGTCGCCGTCATGTTCTTGAGCCAAGTGTTCGTGGAGCTCGGACGGCGTGGACTGCAGTGCTTACAGCGCAGTGTGCCTC
GCTACGTGGCATTCGTAGATCGCTGGTTGGTGCAGTCCATTCGAGTGTCAGTGTATCCCCGGAAGAAGATGAGCACACTGAggctgctgttggcactCGG
AGTGGCGTTCTCCCTGCCGTACATTGTGTTTACTATCCAGAAAATGAGGTTCCCAGCAGGACGAGGGGCTAAAGGGTATGAATGGTGGGGTTTTGTGGGG
GGTTAGTAGTAAAAATTGTGTTGATAAGAGCTTTTTTACACTATGTAGTGCCGATGACCTGGATGAAGAAAAGATTCGATCTCAGATTATTGTGGACCGA
GATGACACATTGATGCCTGGACGACGGCAAATGTTTTTAcgtgaaggaggagatggTTTGAAAGTGGATGATACCAAGTTGAGCTGTGCCAATACTGTTC
AAGGAGTGAGAACTCTCACGGACTCGATGGGTGAGTCATCTGAATGGCATTTCGGTTGCTGGATTGACACACTTATAAGGTGattgctttgctgttgttg
ctattACCGTAGGGCATGTGTGCACTCGAGGGCAACTAGATAAGGTGAAGCCAGGCTGTTGTAACGAATCCGACGCCAGTCTTCCGCGCATCAAGCAGTT
CACGTGTGATCGGTGTGATACCAACCCACCACACTGTTGTGACGTGTATGAACACTGTGTGTCCTGCTGCATGCACCCTCTCAACGTATGTTTTGACAAT
ACCCTCGATTATGCGTCAGGATTGAAGGGGAGCACTTTATGCTAATGGTTTTGGTTGTTGCCACTAGACGGGTATTCGACGAGACTTCTTGACTCATGCA
GACCTCAATCACCCGGTCTATAGCAACCCAGCCGACATCACGGTGTTTCAGTATTGCCAGTACCGTTGTCGAACTGCGTCATCAAGCGTACAACATCAGA
ATTCGTACAGGAGGTATGGATCGTTGTGACGTCCTGGGCTAACTGGCCTATTGAGCATACGCGAGATGCGTTAACCTGTGGGTATTTGTCGGGTTTTGTT
GTGGCAGCCATCGCTCGTACTGCTACGGAATCCATCGGCCTCTGAAGGTGCTCCCGACGGTAAACAGCGACG