Description :
From Genome Similarity Track
Location :
contig_13:771934- 776311
Transcript NameFunction/comments
g3122.t1hypothetical protein

Sequence
4377 bases(100 bases per row)
AGCTTCTACCTCCTCGACGTCGCGCTGGTCCTTGGTCATGAGCAGCTGCAGCGTAGCGTCCTTGAGGTCCATCAGCCGCAGCAGCTTGTCCCGCGCCAGT
TTCACGTCCCCGGAGCTCTCGAAGCGGTCGCTCACCTCCCGCACCACGTACCGCTGCAGCTCCTCGCTCAGATTCAGCAGCTTCTTGGCGTGGGGCTCAA
ACCCGCCGTCCTCGTGCAGGTCCATCCAATTGAACAGCTTCACCAGTAACCAGCATGCATTGGAGGGCGATGCAGCGAGGAAATCCCGCGCCTTCTTGCC
ACCAAACTGTCGGTTCGGGACCACCTTGTCGTGCCAGAACCGAGCACCATCGATAGCCTCCATTTCGTGCTTCAAGGACGCAAGTGCAGAGCTGCTGTCG
TCTGCAATCGCCCCATTGGGGACAAATACAATGCCGTTTCTTCGGAGCGCTAGTTTGGGCTTGTCTCTAGGCTGGAACGGGTTGAGCAGTGCAACGAGTT
TGCTTCTGGCCAATTCCACGCGCTTCTCCAATTTCTCCCGGTCCTCTGGTTCCATGCGCTCGATCAACTGCATCACCTTGGGCGGTGTTGCAACGCGCCT
GTTGAGCACCACGTTCCAGTACTCCACCTTTTGCTCCCGTTTGTCGTAGTCGATGACCCAGGCATACTGCGTGATACGGTTGAACTCGATCGTTTGCAAG
TACAGCAAGCGTGCCTTCCGGACAGCATTCTGCAAGATCTGCCTGAGTTTCACTTGTAAATCTTGCGTGATATTCAGTGCTACTCGTCCAGGTGGCTCGT
ATGGCTGTCGTAAAGCTTCGTCGTAGGGCTCGATATCCTCCCAACGAACCACTGCAGACCGATTGGCGAGAGGGACGAAGACCAACACGCTCCCAGTAAG
CATCAGGTTCTGTGTCGACACGATCGATCCCACGCAGTTCTTCCACTCGCCCTTCAGGATCTTCACCTGGGCGTCGTAGTCACACCAGGTTCTAACAGAC
TCTAGCACCCGAGCCTTTTGTCTCTTGCTCCAGCGCTTTTTCTGGTTAGCCTTGTCTGTTGGTCGTCGTTGAAAGAACAGGGTGCGTTTAATGTCGTCAA
TCCGCTCCTGTCGTGCTGCCATCTCTCGCTTTGTGTCTGACTTCAACGCTGGCGATACCCCAAATGCAGCTTTCGCTTTGTACACGATGGATGCACGCAC
CCTGTCGTCTTTCTTCCGTTGTGCTCGCGCAGCTTGTGTTTGCCTCACTAGCTTCATGTATGCCTTTCCAGACTGACGCGCAACAAATGACCGAATAAGT
GCCTGCATTGTCGTGGCAGCAAGGTGTTGCCGCTGTAGCTCTGCTTCTTGCTGCCTCCTCTCCTTCTCACGCTCTTTCTTTCGCCTCTCTCGCTCTTTCT
CGGCGTCGACATCCCGTTTAAGCTCTGCTTTCTGCCGTAAGATGGAGAAATAGTTCAGCCGGCGACAATGGTGATATTGCCTCTGTCCTTTGGCATGGTA
TGAGCTCATACAACGCTTGCAAAAGACGTCCAAGCATGTTTCGCAAGCCCATTGAGCAACCCGGTCGGAGCACTCAGCGCACATGACCACCAATGTTTGA
AACTTGTGTTGACTTTCCACTGGTTGATCTGTAAGCGATTTGACTTCCTCCTTGGTGAGTGATCCCTGGACTTCTCGTTTCGGTTGTTTAGATGGTTGCT
TGTGCACATGTGGAAAACATGAATCACAGAACGGGGCTTTTCCATTGCCGCATTGAGGCACTCCCTCGTCGCTGTCTCCAATCGACAGTAGTTACACTTT
GAATTTGTCGTCGCTGGTGACGTTGAAAAGCTTGTCGTGCTGTATGATCCCTATCAAAGCAGACTTGGCACATAGCATCTTCACACTCCACGCAATACAC
TTCGGCAGGAACGTTTGAGGCGCTTGGATTCGTGCTGTCTTCGTGACGTTCACAAAAACGCGTGAAATTCTTCTCCGGGGAATGGCAACGGGACGATCTT
GCCGCATTTAACTCCCTTCAAGAAAAGCGGGCGCTTCGTGAGGATTTTTTCGCTACCAATGTGTTGGAACCTAACTGTGCGGCCGGTGTGATCAACGAAT
TCAATAAACATACTCGCGAGCATCTCCTTCAACTGCAAGCAAAACTTGTAGCAGCGATACGCTAGCTGAATCGTAGAGGCACATTTGCTACGATGCTTGT
GCATTTGTTCCTCGCGGAAAAGGATTACAAATTTGTCGTGCCTGTTCTTGGTTGCAATTCTTACCGCAAACCGCCGTAATACTGAAACAGACCACAGCAA
CCGCTTGGTGCAGTGTGCCTCTAACATTTTCCTGTATTTTCCGTTCTGAATGGTTGACGGAAGTACAAAGCGGTTCATGAACCGGAGAAATCGCTCGAGT
TCACTACCAGTATCGACGGGTTCTGAGCCTTTTTTGGCTTCCTTCTCTGGTTGGTGTCCACAAACCTTTCTTTCAGCAACATCAAAATTGCCTGGTTAAA
TCTCTGGAATGAGATGGTCTTTGCTTTTGGTTCCTTCATCTTCGCGAAAATCACATCAGCGTTCTGCATTGGAAACTGGGTCCTGTGAATAAAGGCGTGG
GGTAGTGACTTGAGAAATCTCGCAAAATGAGAATTATCCATCTCCGACGAGTTCCCAGAGGCATTTCGAAAGATTTCCTGCCAAATTCCATCATAGCCTT
TTCGTTTCCACTCTCTTTTCGCAAAGTTCACAACGTACAATGACCGATCAACACGAATTTCCTCCAGTGCATCCCTCTCTTTCTCATCTGCCACCTTCAG
CGCTTTGAAGCAAAAACTTTGCAGCAATAACTCATCCTTAACTCGACTGCGAGTCTTCTCCTCAAGGACCTTGCCTACTGCACCCTCCTCCGCCAGAAAC
TGTCGCCGGCGAACTACTGTAGACAGCATCCTTCTTCCGATGAACTTCCTCGCTGCTCGTTGTAAAATAGCTGCATTGAGTGCACGGAACCGCTGGTTCT
CTAGGTTTCGTCTAGCTTTCCAGCGTGCTTGAATCCTGTTGATCATTTTGAGGGCATATCTCATTTTCAAGAGCTGTATTCGAGTTTTGTATCCTCTCCA
CACGCGTTGGATTCGCTCAGCACTTCTTTCCTCTATCAGTTCCCACGCATAGGCACGTCCTCTTATTCCTCGAACACGCTTCTGAATACAAACCGCCGCA
AGTCTTCGCTTGCGATTGACCTGACGTCTTGATCTCTCTATTTCCTTAGCTTTTTCGTAACGAAGACGCTTGCGGATTTGTTTTCCTCTCCACCGGGCCT
GCAATTTCCTAGCAGCCTGGACTTCTCGCGAGTTGGATGGATCACCAGGCTGAAGCACAGTAGCTGCTTTCAACAGCGAAAATTGATTCCACTTCTTCTG
TAAATGTATCGGAACGAGGGCATTAGATTTCCTGTTTCGACGATCTTCTTCGATTTCATTCAAAAGATGATTACGTTGAGCAAGAGCTTGCTTCTTTCGC
CGCCAGAGCTCACATCTAGCAAGAAAGCACCTCCATGAGCACTGAAGAGTAGCAATTGCTTTACTAATGTCGCGTTTGTGCTTGGTTACCCATCTGCGTC
CTTGTTGGCCTCGATAATGAGCTTGAACCGTAAGTATTTTTTTCTTGTCGCGCTCAAAGGCAGCGCGTCGGCGACGAAGTATTAAAACTTTCTTTTGTTG
CCAATTGCGAAATGCACGCTGAATAAAAATTGCCGCTCCAACCATTTTTGTGTTTTTTGCCCAACCTGCAACTGTAACAGCTTTTTGGCGACGACGCTTT
TCGATGCAATCAATCTTACTCAGTAGAACTCGTCTGCGCTGAGCTAATATCCGCCTCACATACTTCTGAATGACGACAGCAGCGTTAGTTTGTCGTTGCC
TGTGTAGCTCCCGACGTAGTGCTGCCCACTGAGTGCATAATTTTCTCCAGAAACTTTGAATACAGACAGCAGCTTTTTCTCGTGTTGCTGCTCGCTCACG
CGAATGCCGGAAAACATAATTTCGTACGCAACGCGTTATCCTGCAAGCCGCTTGCTGCTCCTTGCTTGCAAGTAGGGCAAGAAAGGCTTCTTGTCTACGT
TGCAATTCATTTCGGATTCTTCTTCGTGTAGAAACTTCACGCTTAGCACATATTTGCCGCCACCAGCATTGTAAGCGGATGCTGGGATACTCCCACTCCT
GTTCTTGCATTGAAAGGACAAACCCTTTCCAATGACGCATTCCTAGGAAGAGTAGTTGATTTTGTAGGCGACTCCAACACGAAATAAAACTTCAGTAGCT
CGTTGCTGGGCTGGCGACGAGAACTTCCCGAACCCAAGCGCGTAAATAACATCAAGAGGAATCCACTGTTTTATCTC