Description :
From Genome Similarity Track
Location :
scaffold_25:771854- 775877
Transcript NameFunction/comments
g2951.t1 hypothetical protein PHYSODRAFT_560159
g2952.t1 hypothetical protein PHYSODRAFT_498950
g2953.t1 conserved hypothetical protein

Sequence
4023 bases(100 bases per row)
CTCGGTGTGCTTGTCTTTGGTGACCAGCTCCATTTCTACCTGCTTGAACGCGGCCACGTAATTGTACTTCTCATAACCCAGCCTGCATGGTGAAAAATGT
GCGAGAGCAGTTAGTCGCTTGCTCAAGAGCAAAACAGCACGACATGCAAACTTACTTTTCGAAGAGCTGCAATGAAGCACCGTTCGTCTCGATGATCTTG
CAGACAAATCGGGTGACGTGGAGCTTCGACGTTGCTGTATACGGGGAAAAATGAAGAACACAAGAGCTCGTTGGTCTCATAACTCAGCCATCCACGACAC
TGCTTCATACCGTAAGCCATCATGAGCTTCACTGCCTCCTCCGCAAATCCCTTGCGGCGATACTTCTCCTCGGCGATCATGATCTCCATCTCACACGCTT
TGGGGTCGTCATAGTCGTTGAAGAACAAGTTCACGTCCCCCGCCATGCCTGCAACCACCCATTAGTCACATATCGCGTCTTCCACCATAAAATCTCCCAC
ACAGCAACCAACTCACGGTCAACGGCACTCTCGTCGACGTACGAGGCGCCTGGTTTGCCGTCACCCTCGGACTTTTCCAGTACAATGAAAGTGCACTCTG
CCAAAGGCATCAAAAGGGTAGAAACTAAGTCCACACAAAACTATCTTCGGCATTGACAGCTCGTACTCTCGGCATCTTCTCTCCACGACTTTTGCATCTC
CAACTCCTCTTCGATCGACAGTGGCTCCGACGCCGTCATCTCTGCAGCAAAACAAAATCCATGAGAGATCCACAGAAAATAGGTTCACACTACTGCAAAA
TGGTCGCAATTACCTTGCAGCCACGGGTCCTTCATCCAGTTGTGGTACTTGGCCACATGCTGCGTCTCGTACGGCACCAGCGTCACCTGCTGCCCAGTCT
GTAGACAATATAAACAACACCGAACAATACTCTTCATTAGCTTCCATTGCACAATAATATAGGTACTCGTCAATGCACTGGCCGTACAATCACAACACCC
GCGTTCGCCTTCATGTTGACAAGTCTCACACTGCGGCCAGGAGCTAACTTAATAATGGTCCAATCATATTGTTTTTTACCTTGTATTCTAGAATGTAGAT
AATGATAGATTGTAGGATTAGCTAGAAGACGTGACAACCAGATCAGAATGAGTGGCCTCGCCGCGCTCGAGGTGCCGTTCACGGAGGTTCTGCTGATGTT
ACTACGCCACCAGTGGGTCGATGTAATGTGCCTCTCTCTCCACTTTCGACTGGTAGAATTTTCGCTGCGTACTGACGTCTATGGGCGCTGCAATCTGAGG
TGAACGATGTGGAGGCCGTTGCTGGAGTGAACAGGAGCTTGCGATCCGTCGTGGAGACTCGCAAGCTGCGACGTCTAGCGGTGCGTGCCAGCGGATTCCC
CAAAGCTTCAAGATTCAGGTACGAGGTCCTTATAAACGCAAGTGGGGGATGGTTGGTTCAAGCTCACAGGTGTCCATGACGTTGAAGCTACTGGCTGCGA
GCTGGGGACGTGTCAACGCTCATGAAGGAGATTCCAGAGGGGGCGAGCAGCCAGGATTTGTTCCTCAAGGTGAGGAGACTGTTGAGCTTTGTAGGAGGGC
GGGGGCTCATGACGTGCTGCTGTGCTGCAGCTGACGGGGGATGGAGAGGTTGGAGGACGAGGCATCGCTTGAGAGCACAGGCGTAGAAGGTGGGGATTGT
GCTGGAGACAGGAGAGATAGAGGAGAGAGTAATGGGCGATTGGTGATTGCAGGAGAGATCGAGCGCGATGTAGAGCGAACTTTCCCAGCGAACCCCTTTT
TTTCGGACCAAGGTGAGAGCTGTGGTCGAGGCATCAAGCTTCTGCTGGCGTTCCTCTTGAATTGACAGTGCTGTTTCGTAGGCGACGGTAGACGGATGCT
TAGCAATGTGCTGAAGGCGGTCGCTCATCATGCAGACGACGTTGGCTACTGCCAGGTGCGAAGCTGGACGGTGACTGCAAGTAGAGCCGACCAGCTAACG
ACAAAGATGGCGCTGTGTGCGTTGCTTATCAGGGGATGAACTACGTCGTCGCTGCACTGCTGCTTGTGATAAAAGATGCAAAAGATACTGCTGACGTGGG
AATCGATGGACTCTCCCTGCAAGAAGCGGTGTTTTGGCTAACGCTGTCTTTGATTCGGCGCAAGGGGATGGCAGATTTGTGGAAGCGCAAAATGCCAGGG
TGCGTTTTATCTGGTATTTGGAGCTGAGACTACGTGAGCTAATTGCTATTTTGTATGTGGTGATGGTGCAGACTTTCCCAATGTATTTACCTATTTCAGC
AGCTGCTTAAGCTCCACTTTTACGATCTATCAGCGCACCTCCGACAAATTGGGTTGCACTCTAATATCCTAGCCACGCAGGTAAGAACACTGGGAATGCG
GGTTTATTCGAATCTTTGACATTTCGATGTGCAGTGGTTTGTGACGCTATTTGCTCGAGTGCTTACACTTCCTACACTTGTTCGAGTGTGGGATCTCTTC
TTTATGGACGGGTGGAAAGCGGTATATCGAGTCGCGCTCGCCATTACAGCAGAATTGCGACCAAAGCTTCTCATGATGGTATGGTGACGCTGCAGCAAAC
AGTCACCTACGTTTTCTGATTGCGCTCTATCGTTTTGGTTTACCGCAAAACAGGATTTGGAGCAGTGCAGCGAGTTTTTCCGCAAGAACCCAAAGTTGGG
CTTGGAAGAGGTATTTGGTCCAGGAATACTGCTGGAGCGTGCACTGGAGTACAAAGTGACGCGCTCAAGCCTGCAGCAACTGGAGGAAGAGCGACATCTC
GAGGTAAGAAAGTCTTGGCCAGTCTTCTGTCAGGACAGATTGGTAAGCTGGTTGTGTATTTCACGCTTTGTTAGTACTTGCGTCTTCGACTACAGCAAAC
TCCACTATCCGAAGAGCATCGTATGCTGTTTCCTGCCCTCGAGCGTGAAGGCGATGCTGCTGCACAGCGAAAGGCTCTGGAGCTGATCCGTTCAAAGCTG
AAGCGTTTCGACTCGGACGTCGCGAGTGACACAATTATTCTTCAGCAGAAAATCGAGGCAGCTGAGCGCGCGCAGGCCCAGGCGATGTCAGTTCGCTATG
CCATTGCGTACGAGCTGTCCGAGGCTGCGATTGAGCTGAATGAGCGTGTCGAGGTGAAAAACCGACTGCGCTCGAAGTTCCGCAAGCTCATGTCAGTCGC
GATTGCAGCAGCTTCTTCGTCGTCGTCTTCTTCAGCAAGGTCTTCTGCGTCAGTCCTTCCGAGCTGGGTCCATCCGTTCGACTTCATCAACGAGCGAATG
GCCAGTTGCTTTGAGCGTCTGCCTCTGATTTCCAGCTTTACCGACAGCGGGTACATCGACACCGACGACGAAGAAGACGAAGAGGTACAACGGAACTTGG
TGCATCTCAATGCGCTGGTGCCTGAGATGGCGGCAGAATTGCGTCTCCTGCAGCGCTCGGTGGCCTACAACGAGCGCTTTCTGCGTCCACTGCTACAGCG
GACGAGTCGCCTTCAGCGTGACGCGCAGCTTGCTCGTGTTGAAGTGGAGGAGACACAGCAGTTCAAAGACCGATTGGCAGACCAATTGCTGCAGATTATG
CTGGCCAGCGAGAAGCTCAAGAACGAGCGGATGCAGCAGCTCTTTGCTGAGGTCGATCGTAGCTGATAGCACGAAGGACGCTGCGTACGTGATAAACGTT
GGAAGTATCTACTGTATTACTACCGATGTGGAAGCAGACACGCACTAGAGTAAAAGGCGAAAGACCTCACAAGCTCTTCCTTGGTAGCAAGCGAGGGCTT
CTCCCCCTTTCAGCGTGCTTGGTTCCGTGCTGTTGTATGTCCAGAGGCGGTCACACATGAGCTAGACCCTCTTGGCTTACTCGTCCTCCGTCACGACGTC
AGCGTCCGCGAACTCGGCCGCCACGGCGGGCTCAGCGACAATGGGAGCCATGCCCGGGCCCCACGAAGGGAGATCGGCAGCAACGCCACCGAGCGACGGG
AAGGCGTCCTTGTCGCTGGCGTT