Description :
From Genome Similarity Track
Location :
Scaffold_5:771750- 786780
Transcript NameFunction/comments
Phyci_101103Hypothetical protein
Phyci_209409conserved hypothetical protein
Phyci_209973importin-like protein

Sequence
15030 bases(100 bases per row)
CACTTCAACTTCGATCTGTGACTTGCGACGAGCAATAACGGTCTACCTTTCCGTCGTGTGTGCCACACCACTTTCATCAGCATTGAAGAAACGGGCACAA
AGAGAAGCACTTTAGACCCGCCAGGGCGCCAAGCGGAGGGAGGCGCAGGCGGGCGGGCGCCATGACCATGAAGGGCGCCAAGACGGACGCGGAGTGGTTT
TCCCCAGAGGAGCTGGCGGCCGCACGCGAGGACTATCTGCAGGAGCAGGAGAAGGAGCAGCCGTCGCCCCAGGTATCAGGCCGGCGGATTCCGATGATCT
GAGTCGGATGCCTCAATTGTATTGAGTACCCCTCGGCATTCTGCTCGATTACGTTAACATTTTTTTTTATTTTTTGTGTTTCTTTTGTTGCGGGAGGAGT
GCAGGTCAAGCTACGATATGCCATTGCGCTGGCGAAAAGCAGGAAACGCGACGACAAGTACCGTGCGATCGGGCTACTCGAAGGTGACAGCAGTACAGTA
CACGCTTTGAAAAGCAAAACAGTCAAGTTGAAGTGCTAACTACTGTACGATCTGCTTTAACGCACGAGCAGATCTGCTGGAGCAGAGCTACGCCCCCAAG
GAAAGCTTGTACTGGATCGCGCTGACGCTATGCGGGCTGGGCGACTACCGCTCCAGCCGCAGTTACTGCGAGCGCTTGCTCCGGATGGACCCGTCACACA
TGAAGGCGCAGCTGCTGCACAAGAGGATCAAGGAGGTCGTGGCAAAAGGTCTGTGGGGTGCTGCTGCTTTTGTATTGCTAGTGGGGCAGGCTTATCGAGG
CTGTTGCTTGGTGTACCAGAGGACGGCGTGGTGGGAGTGGGCATTGTCGGGGCGGTGGTGGTGGCTGGACTAGCACTTAAGTTTTTGCTCAAGAGATAAG
CCGTGGATGTGAGTAGGCAAGTCCAGTAAAGTGATGTAGTCGCCGTTCTCTCCAGCTTCCGACTGAGCAACACGTTAGACGCTGAGAGCTGCACAAATGT
TCTGATACACAACCTCTTATACTACTACACTACGCGACCGGCAAGGCTGAGGACGGAGGTGCAGGCAAGTAAGTCAACTTCAACTTTGAAAACAGAAAAG
GCTATCGTGTTGAAGATACACAAATTGAGAATATCATCTCCGAATTATCTTTCTATTCATTAGCAGGCCACAATACCACCAGCGCAGCAGCCGCAGCCTG
CGAACGCGACAAAACTACTTACTACCTATCGTTTCTCGTATCTCTATATGCATGCCCTATGTCGTCAATCCATAACCAAGTTCGTCCCTTACAGCTGAGA
GAGCGCCTGCTGCTCGTCGCCGCTGAGCTTGGACCAGGCACCCTGCACCACCGGGCCGGGCAGCTGCGACTGCAGCTTCGCTAGCAGCTCGCGAAGCTGC
GGCTTGGTCTCCTCCGAAATGGTCGACATGTCCTCGTCGTCCGCGGCATCCTCCGCGGCCGCCAAGTCGAACACTGCATATTANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGTGGcgggggagacgggattccccggaccgaagccgttggaggaaggcctggg
ccgggCggatgcacgttgcgacgtggcgcagtgatccgatgagggagcggaactcgctgcgagtgatgcgggatgcctggaatgcagatctgacgcgttg
ccgcgccttcattatcttcgctgttggcatcgcgacgattcccgcagcggtgccgaagatgagacccaagacttgttggcgagagcgccacggggtaaac
ttgtcctcgttgacggccgctggacccatgatggtcgtcatcgcgaagcgaagcgagcgctcgatgtcggcgcagcgagtgccggtgtcggccgccacat
tgacgtggtcatcgacccagtggtagctgaagaaccccgtcgggtgctcagggtcaacgctgctgccgtgcaggaaggcgacggctccgccaaggacgct
gtacacgccggccgaccctgaccacccgaaagcggccgacaagtcgatgacgatggcgttgtcctcgggaatgtggcctccaaacaagtggaccgactcg
ctgtggatgcacgcgtttcggtaggcggccgccacgtcgccagccataacctttacctcgcagtcggggttcgcttgtttacaacgggtgatttctttgg
cgatgcgcgagcagtgttcgaacgtggccttgggaacgctgtccaggtcggtacactggttcactgactcgacctcggggaatgagagatcgtggattgt
cctgcctgtagtctggggatccccggtgcctttgtcgaccacgccgaaagggctcatgatgagctcgggccagatgctgaagatgtcggcgtcgactacg
aggcagcgcagtaagtcttgctccttcctgatattcttccgcagcacattgattcgagccgatgcggaagggtggttccgggggaaacgggcctgtcttg
gaggcgccttccgaagctggacgcggactccctcggacgcgatgcgcaagagttcgctcagctgggggtacccgcggcactgtgttattagtgtggacgg
caggagcgctttgttgggtcggtagtcCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCGAAGCTGCGGCTTGGTCTCCTCCGAAATGGTCGACATGTCCTCGTCGTCCGCGGCATCCTCCGCG
GCCGCCAAGTCGAACACTGCATATTAAGTACACAGAAAACGGAGCATTAGATACTAGTTCACACGGCATCCACAGACAGGGTATGAACTTACGAAGAGCA
GACGCGAACACCTTCAGGATCTGGGGGAGGTTGGCGTAGTCAGCGCCGATCACGTTGGCGTTGCCGCTGTTCACCAGCGAAATCAGGCGAGCGTGCACGT
CGCGGGCCTCAAGCACGTCCGTGCGGAGCGGCAGCCAGCTGAGCCACATCGGCCACATCTTGGCGGCGTCCACAGCACCCTCGCGAGCCAGGCAGATCTT
CGCCACGGCGCTGATAGCGTTGTCGCGCGCGGCACCAACTTCATCATCATCCACGTTGGCCGACACGTTGATCAGATGCACCATCTTCTCCAGCGCGTTC
TGGCAAAACGGGTCGAACGCAGCACCGCACTTCTCAGCGCTGACACCGATGCCGTAGGCGGACGCCTGGATCACGGACGGGCTCTGATCCTCCAGACCCT
GCACCAGGTGGTTCAGGAACAGCGGCACCAGCTCCTGAGCGGCAGCACCGCAGTGCTCAATGATGTCGTCGATCATGCAGATAGCCTGGCCGCGCAGCAT
GGGCACCGTCTTCTGCTCGAGCAGCGGAGTCACGAACGCCAGCAGGTGCGACTGGAACACAGGGAAGAAGGCCTCCTTCTGAATCTTCACGATCCAGCCG
ATAGAGTCGACCATCGAGCGGAAAACACCCTCCTCGAGCTCGTCGTTCTCCGTCTGCTGCAGAGCAGCCTCGGCGTCGTAGTCCTCGTCCTGCTGGTTCT
CGTGGTGCTGCGTCATGAGGCGCTGAGCGCTGTTGGACGCCACCGTCTTGAAAATCTCAACCACACGCGGGACGTGCTCAAGAGGAATGCCAACCTGGAA
GCCCTTCTCCTGGCTCTCCTTGCACACCTCAAGGACGGCAGACATGGCCTCGGCAAAAGCACCAAGGCACTCCAGGTCCTCCTCCTCCTGCAGGCCCTTC
AGCATCGGCTCGAAGAACTTCTCAAACAACTGCTGGGGGAACTGTGGCGCGGTCGCACCGTGGCCGTGGTTGAGCGTGCCGTCCACCGCGCAGTTCAGCA
GCTTGGCCATGGTCAGGCTGCTCACAATGCGGATGTCCTCCACGTACTCAAAGTCAATCAGCGGGATCATCACCTGCGCCACCTCAGCGACGTAGGGAta
gaaccagccctccaggtccagggccgactggtacagcatgttgcacgcgttggtcttgtcctcgagcgcgctggtgttgatctccaggcgcttcttgccc
acaccacggatctcgagtgtcatagtgtccttgccatccgccgtctggccatcctcctcgacgtcgtcgtcggcgacatcggacagctgaatgtccggct
gaatctgcgcctgcttgatcagagccgggatcacgtgaggcaggtatggcacgaagtcctccttcaggatgctgccaatgcgcacgcacgactgcgcaac
gtactgcacctcaggaccctccagctcctcgctggactgcacgcgcaccaggatctccatgatctccttggcgtcgttcacgaagcgctccttgccgaca
gcctggccgatcagggcgattgactccatggacttgCCACGCAGCAGCGAGTACTCCTTACCGTGAGCGTTCGTCAGAACCTCCTTGGCAAGCGGGATGA
AAATGTCGTAGAAGCGCAGGAACTCGTCGCCAATGACCTTCGCGACGCTAGCCACAGCCGTGATGGCCTGCTCCTGGACCTGACGCGGGCAGGAGcgcat
cgcgttgaaaagagcctcgagcagagcctggctgtacggggccacgtacttggccttgcacacgttcgtgttgcagaagttgatgaccacactggcggcc
agagcacgggtgcgcagcacgccctgctcgttctggattagcgccgtaagggccggcacaaccacggcgtggaacttagcctggaagttcttgcccttct
ccacttcgccaaagtcctcagcgatctggccgatgctgtgcagagcagcgtactgcacgcgcgggtgctggtcgttcaggaagggcagcaccatgcccac
cacgttgtcgagctcgcgcgtcatgagcgacttggcgccctcgcccagcaggcaggtagcgtacaggccagcgcggcgcttacgccagtcagcgtcgccc
agggagcccttgatgaccgggatggccaccggcagcacggcgttgccgcccagcgacgagctgaggcggtcgattgcagcggcacccgcgtcgctgatcg
agttgtcggcgtcgttgGCCTCCGTGAAGGTCTCGGGGTCGTCGAACTTTTGCACCCACGTCTCGTCCTCCTCCACCTCGCACATGAGCTGGATGACCAG
GGGCACGACGTTGGAGACGATGAACTGCGACTTGCGCACCATGCCGCCGGCGTTCTCGCAGATCGAGATGAGGAACTCGAGCGCGAGCTCGCGGGTCTCC
GAGTCCAGCTCCTGGTTCGAGCACACGAAGATCATGGCGCGGGCCACGTCGTCCAGCGAGTTGCGGAAGAACTTGGGGTGCACCTCGGCGGTCTGCACGA
GGGCGGACAGCACCTCGCGGAAGGCGACCTCGTCGCCCGAGCTGACCAGCGCCTGGATGATGCGCAGCATGGGGGCGGTGATGATGGCGAAGGCGGACAG
CTCCTGCTTGTCCTCGAGCGTGAGCAGGAAGGCCGACGCGGCCTTGAGCGCGGCGATCTGCACCTCGCCGCTGGCGTCGTTGAGCGCGTTGGTGAAGAGC
GTGAGGAAGCTCTCCTTGTGCGGGGCCAGCAGCTCACCCACATACTCGGCCAGCTTGGCCAGCAGGTCGAAGGCCGTGACGCGCAGCAGCGCGTCCGCGT
GTGTCGTGAGCGCCGAGACGGCGTTCAGCAGCTCGGGCCAGGCCTGCTCATACTTCTGCGAGATGGCGGCCAGCTCGGCGATCAGGTGGCCGAGCTTGCG
GCGGATGTGCGCCACGGGCTCGCTGGCCACGGCCTCCAGCAGCTGCGCCTTGAGCGTGGCCTGCGCGGCCACGTCCAGCTGCGTGTACACGCCGGCCTTG
ACCTCCAGCAGCGGGCGCAGCAGCACGGGCGCGAAGGCGCGCGCCTCGGGCTCGGGGGCGGCGCGCAGCAGCTGCACCAGGTTGGCCACGAGCGTCTGCG
GCTGCTCGGCCTTGAAGGCCTCGTACGAGGCCTCGGCCTGCTTGCGCGTGGCGTTGTCGTTGCTCATGAGAGCGGCCACCAGCGCCGGGAAGTCCATGGT
GGGCGGGGCGGGCGGGGGCAGGAGAGGACGAGACCGGGGAGTGCGAACCTGCTGCTCGGCCGGCGACTTTGGGAATGACTCGGGAGCAGCGCAGCCAGCC
AGCTCAGCCACTCGATCAGCTGTTTCCTGAAATGGCTACCAAAATGCGCGGGAAGCCGTGCGGCGTATGATAGTACTGTATGAAATTTTCTCGATAGTAT
TTATCACAATAGTACTTACGGATGATACTGCTATTTGTATTATATAACATTAATAATTCTATCGACTTTTTTAAAAAAGTGACTCACCGACAGGTGTTAT
TGTAGCACGCGGTGCCCCCCAGCATGCACAGCTGTGGTTGCCAAGTAATGACCTCGACAAGAAGGGTATTTTTCTGTTGCTGACCGAAATATACCTATAG
TACTGTATACAGCTTGCTGAAAGTTATTTATGGTCGGACCAATTCCAGCTCTACCACTATACATCAGCAGCTGAGTTCACTGCCAGCGCCCTCGTGAGGC
CAATAGCATTCTATTCAAACCAGATTTGAGCTCAGAAGTAGCTGTTTAAATCCGTGGAAATGTGCGGGTTTATTAGGTTCCTGCAGGGAGGTGACGCTCT
TCAACTCAGGTCTACCGTTAAGCGTAGGAAACCGTTTGCTGTTGAACGTGTCCGTTCAGATAAACGCTGGCGTGTTGTTTCTGTGTGTTTCAGATAAGAA
AGTCCCGCTCTGACTTTGTTGAGAACAGGGCTAAGAACATTCCAATAATACACTGGGCCCCCGTCCTCAATTTGATGCAATAAAATTAAAGCCTACCGCC
GAACGTGTGGTTGATTTGAACATTTCAATACATCAATTTGGGCCTTGTTAGAGATAATGTGCAGGCAGCAGGAAATATGTATTACAGACGTACCACACGG
AAAGTAGATTATCTCTGTTGCGCAGGCCTTCACTTCAGCAGTTTTATCTCGCCAACACGATGGATACATAGTGGAAAAAAATAAGAAACATTAGTTATTG
GCGAAGACTGGAGCACCCAACCATTATCATATTGTATTTTGCGGAGCAATGGCTTAGAAATTCCAGACGCGTATTGTGAGGCTTAGTTCTAACTGCGTGC
CATGGTGTCACGCCATGCCGTGGCGCTATCCACCGAGGTTACATGTTCTCCCGCTTCTGAATGAATTGGATGGTAAGATGATATGCGTACATTTTAGCAC
CACCTCGATGCAAAAAACAACCGGCACAGATTCAGAGCTGGTAATTGTGAGCAGAACGAAGTTTTGCTGTACGGGGCAATTTCGTCACTACTAAGTACTG
TGTACTGTGTGCACTTCCATGGCGCCAATA