Description :
From Genome Similarity Track
Location :
Scaffold_1:771737- 778769
Sequence
7032 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGTAAGATAACTTTCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTTAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GATGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGACCGAAGGTTAAGCCGTATGAAGGGAAGGAACGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCG
TGCTAAGAGTTGGGTGTACACTCTAGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGTGTCCT
TAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCT
CCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCA
AGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGTGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGC
CGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTC
TTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTTGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTCAGAATCTTGATTGACTCTGG
GGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTG
CGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGAACTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCG
ATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACAAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGC
GCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGG
GAGTCGTCGACGTATATGACAACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAA
CTTAGCTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAA
GAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCTCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTG
TGGGTAACACAGTGCCACACGCGGTCTCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTCCCTGTGTGGGTAACACAGTGCCACACGCGGTCGC
CCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACAAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACA
TCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCGAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCG
CTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGTGAGACAGGTTTACCCGTCAAGGC
ATCTGATGTCCACTTGGAACCGCTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAG
ATTGCTGAGATGCTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGC
GTCAGGCGCGCTTGGGTTCTGCGATTCTCGAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAATATGCGGACGTGGTGAACAAACACCCACAGAC
CCAACTCCCACCGGATCGAGGCCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCCCGCGAACAGTG
CGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTTCGTCCGTAAACCG
AACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAGCGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTTTTGTTGAACAACA
TGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACTTCCCGCTCACCGCGGTAAGCACTCC
AAGCGGCATGCTTTGGGAGTGGCTCATCATGCCGAAGGGTTTGTCTAACGCCCCGGCGACCTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGT
ACCTTCGTACAGACGTACTTCGACGACATCTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGTCACCTCCGTCGAGTGT
TGGACGTGATGCGAGCGAACAAGCGCTACGCCAACATTGACAAGTGCGTTTTTGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGG
CGTTCCGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTT
CACAAGTACAACGCTGGGTACGCGGGCTTCGCTACGCCCTTGTCGAGCTTCCTTCAGAAGGACGTCGACTGGCGCTGGGGACAAGAGCACCAGGATGCTT
TTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTACCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCAT
CGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGGCTGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATG
ACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAATTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAG
GACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTACGCGTCGAATACAAGCCGGGCAAGCTC
AACGTGCTTGCGGACGCACTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGCGACAACGGATCTATATGATCGGATACGCATGGCGTATC
GGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCG
ATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCATGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTG
GCGGAGGCGCATGACGCGCCCTCCGGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGG
TCGCCCGTACGTCAAGACATGAGAAACATGTCAGCGGGTCAAACCCGCGGGGCACTCTTCGGCTTACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGA
AGTCGATGAGCCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCT
TGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGCTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGAT
CGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCC
AAACAAAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGCTGTTGAGTTTGC
GCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGCGTGCCTCTCACTCTTCGAGGAGACACTGAC
TCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGG
ATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAG
TATATTTGAGGTTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCTGCAACAAACTGAAGCACCGCTTCATC
GGACCTTTTGCAGTTCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGC
GGTACTTTGACCCGCAGGGGGTTCCTGACTCGCAGACCCCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAG
TAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGC
TGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGCTCCGGACGTGGCAACAAAGCTTCGATCCGTCGGATCATGCGAAAGG
CCTCGTCCAGATCGGACGAAGAGGCCCGGGGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAG
CTCGCTCTGATTCCCGGCCTGAGCGGCAGCTTTACCGCCAGTCCCAAGGCCAAGTGCAATCTCACGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCA
GGGTCCCGTGTCGTACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTT
GACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCC
ACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAGGCGGCGGCAGCTTCATAAGTAGTC
CGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCA
GCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGT
GGGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCCTCACAAGAACTCCACGTGGGACAGTTCTCGGTCATAACCCAGGGGTATCCCCAAAC
AGGATAAAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGATCAGCCTCC
AAGTTGTCGACGAACAACTGTTCCTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAACCT
CTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGACAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACG
CACACGCTGGGCGGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCCTCTTCTTCCTCC
TTCTCCTCCTCTTCAGCCGAGGAGTCGAAGAG