Description :
From Genome Similarity Track
Location :
Scaffold_111:77171- 79716
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14058predicted protein
Sappa_CBS223.65SPRG_14059predicted protein

Sequence
2545 bases(100 bases per row)
CTAGACTTGTGACAGAATTCTTCCGGTAACGTGCCTCATGGAGAATTCCAGCTCACAAACCAAGCTCGTTTTTGACCGATTTGGTGGTGGGTTGTTGTGT
GCTACTCGTACTATACGGTACGGCTGCGTTGTCTCTGTGTTGGGTCGTTGCCAGCAATCGCTTGCTTGCTGGATGCTGCTGGACGGCTGCGGGCTATGTT
GAGAGCGCATGTGCGTCTTCTCGCCGCCAATCACGACGAAGATAATACTAGTTTTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA
GATAGATAGATAGATAGATAGATAGATACTTGCATTCATCAACACAGGTTATGCTAGTCGCAAAACCACGGTAGCTCAATGCTACCGCTGCGTTTCCGTT
GTTTACCGCGGCTTGTTCCAGACCCACTTGTTGCCCGAGTACTTGACGCCGTCGCGGACGGGGCACCCGCCGTGGAGGCTCATTGGGTCGAGGGATCCAT
CCGGGAGCATGCTACACCAAAGGTTCTTCCTCATGCAAGAATGGTATTCGCCACATACCTGTAAAATACGATCACCTTGCCCTTCTTGGGGGCGACAAGG
AGGCCTTTTGTGCAGTCGGTCATCGAGTCGGGCTGTGGACGGCCGCCGGCGCGGGGAAACGCCGTGTGGCCACCGTCCGCGACGTCCGACATGTACCAAA
AGACCGTGATCATGCGGTTCTTGAAGCCTTGATGGAGGTATTCTTGAAACTCAGGGCTGTTGTCGTACATGTTGGCGTCAAAATAGTCGGTGTGGTGGTC
GTATTTTTGCGTTTTTTCGTAGCGAAGCACTTGGACTGGCTCCTGGTGCGTCTTGTGCACCTTGACGAGCGCTTCGACACGGTCGTCGATCTCTACGCAC
AACGATATATGTCACAACTAATACAAGGTGTCTGGTGCTTGTACGCGCCAAAATCGGACTCTCGGACGACGGGAGAAAGTACTGCGAGCTCGTGCGCCAC
TCGGACGCGGGCTTGTCTTCGTCTCCGTCTTGGAGCTTGACCGCTACGCCCATCGAGTTATGTGCGCAAGACTGCAATGCGTACTGGAGGCGGCGAGGTA
TGGCAGCGCAAGCTCGACAATCGCGTCGATCTCGTCGTTGTGAAGAAATCGGTCGACCGCCAGCACGAGCGGCTGCATGGATAGTGTCTCGAGCACGACA
TCGCCGAGCCCTGGGAGGTCGGGTACAACCCGCCGATGTCCAACGTAGAGCCCAGGCCAGACGAACTGGCCGCCTTCAAAGAGATACACGACGTTGCTAT
CGAGCAGCTGGTCCATGAACGCGAGCAATTCGCCGTCGGGGGCGTAAAACTGAGGCGGCTGCTTCCACTGCAGGTCATCCACGTCCTCAAAGCTCGACCT
TGGCAGCGCACGCAGGAGCTCGTGGAGATCACGCGCAGTCGTGTAGTACGAAGGGTACCCCAGGACACCGTCCTCGTACACGAGCCCTTGGATCCTAAAG
GTGCACAATTTTGGACTCCTGGTCAACCATCAGGGGTACTACGTGTTGTTGGCCGTGGCTGCGAGGCAGAGGACGTGGAAGCCGCGGACGAACGTGGTGT
TGGACAAGTGCGGAGCGGCGGCCGCCTTGCACGCGGATACGTTGAAGGCAGGATCAACCTCGAAATGAATCGCTGGCGCCAAGAGAGAGGCGATGAGGTG
GGTGTAGTCGACAAGCGTCGGAGGCGAGATTGAGTAGAGGCCGATGGCCACAGCGACAAGCAGCGTGAGCGCGTGGGCCCGCGTGCTCATGTGGCTGTCA
GTATCGATGTGGGAGTCTATGCTGCCCGCAACGTACGTTGCGAACCTTCCATACTGCGCTTCACCGTCTAAAAACGAAAGAAACGCTGCGGTGCATGCAC
GAGAAGGGGTTGCCGGAAATTGGGCAGCTGTGGTGCAGCTCTGTCAAGATGCGGCTGGCACTTAGTTGACCACCTTTTGTCCAGTTAGTGGATTCCTGCT
CCACATGACAATTGAATGTTAGGGACAATGGCATGGCGCACGAGCTTATCATAAAGGCAATCAAGCTACGAGGGCCTCCGGACAATTTTATAAAAAGAAA
CGAACGACATCACCCCATATCGACAAACTTGTTTCCTGACATAGGATTCCTTCTTAACAAACAGGCATGATCAGGTTCAAGCCCATAAAGGCCTAACGTG
TCGTCTGTGCAGTTCCCTTTTGCAACTCGTCAACTATTGAGCTCCACCGGCGAAATGACATGCGAGTGTATGAAAGTCCCAATGATGGTATCTTATGTCG
ACGTGCGTGGGTTGATCTCCAAACTGAACGAGCGGCTCAAAAAAGGGTGACCACACGCGTTGGCAATTCAATTTTTGAGCATCGATCATTGAGATTAAGT
TCCGCAACCGGTGGCGACGCATGTGATTGGTCAAAATCCTTTGTTGTACGTACCGCCGATTGGCTAGAACCCAAGTGGGCGCACCAATCGGTGCGTCGCA
GCGGCGCCAGTCTAAGATTTGCCGTGTGGCGAGAAGAGCAGCATG