Description :
From Genome Similarity Track
Location :
Scaffold_35:77167- 78430
Transcript NameFunction/comments
Physo_134961hypothetical protein

Sequence
1263 bases(100 bases per row)
AGTTCTCAACAAAAACATTCCTACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGTGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGCTCGTG
AAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGGATCCCGCTGCATACGTACAGC
GGAATTTCATTTGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAAC
TTGAAGACGCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCAGAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTGGAGCTCGAAGCGTCCGAGTC
GTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAATAGGCTTCGCCCTCTTCCATC
TCTACGTCGTCACTCCCGTAGTCAACGGCGTCGTTGGCTACAGAGGAACTTTCGAGGACAACTTCCGGCTGGGTTGTCCCCGACGCGGCCTTTGCAGCGA
GCGCGTCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGATATGTTACCCTCTGTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGA
ATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTCCCTGATTGACGTGCCGTGACTCGGCGCGTCGAACCTTGAGGGGGGAT
GGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTA
GACACACCAAAGGCTATATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAG
CGACATGCATAGCATTGGAATTCTGTCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGC
AGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTAC
GCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGTCCACTACA