Description :
From Genome Similarity Track
Location :
Scaffold_113:77146- 80212
Transcript NameFunction/comments
Phyca_LT1534131794Hypothetical protein

Sequence
3066 bases(100 bases per row)
cgagtcatgcacagcctccgtcgccacgaattccaccggcaacggcacgtacggaatatgctcgcacgtagcctgnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnntcagctgaaagtatcgatactctccgatgcccggtagaaatttgcccatatcacatgtatcggacattaggcgctcgtagt
ttatttttgtgcgcttgtccaccgcgctcttcttgtacgacattctccttgccttggccgacaaacacgtgacgcacttgaannnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccttcttcttcttc
ttcgccttcccgatcttctcgactccctctttaccttattcagttgccttcttctgcttgttgagatagtgccagcaatctcgcttcaggtggccttgtt
tcccacaatgatagcacttcagcttcttccacgcgaccttacctttcttgttgttcttcacgttggtcgaagtagcgctcatcaccgcttgaggaactcc
attgccatccacagcaccacccatcgcttcagccatgcgcaaacgttcatccttggacaatagcgcgttcgagaagtcctgcaacgtcggcgggtgtccc
tgacgagtcggcaggtcgaactgctgcaccagctccgggtgtgatagctgcactacagttgtcagcgcgcttagcatctctccgtcagtcaccaccgttc
ccatcgttctcaactgctgccgaatccggttcatcaccgccaggtactcagccatcggttgccctttcacatgtcttgtcgtgtagagctgacccttgag
caatgagacgtaagggaagtctctcttcgtcttgtcggcgacaatcgtgtcccacatctcctttgccgtagccatccgacaaaccttgtctgcttgatcg
tcttgacagccacgaagtccacgcaggattgtagctttcgccagccgattcttgttgtcgaaatcaacgcgttggttagcgtcatttgggtcgcacacca
ccgctccggtgacgacatcccacgcttctcgttcctccagatacagctccacttcaacttgatacacctcgaaggtgccctcgaatcttggagccttcga
gcttcctctcatcgcattcgccatctcagttgtagttattcaattccttcacgtagagccttgggctcataacctagcagctttggcgcactaagttctt
gtcttgacgctgcacttcgtagttcgtagcacagcaagtcgttagctctgtcgtagtggtaggtaaaaccaaaagtgttattgattcttattagacgtac
tgtcggaatacagcacgaggaggaaagttccaagacagtaaaccccctttagacaagtggaatgttccacaagtctttcccaatcagatagactgaaagg
ccttgacacaagcgagagttctttggttacgagtcgaaagctcatagtgttgagtaccaatgcggaaaggatcgcccactgtcaaaaagcagagtgattg
tcaagactcaggctcactttactcttattgtgtttgtgttttgaactgcaattttggctcgaacttagagccctttgggaaaagacgcagtcggtgcaaa
gccgcgagtaaggttcgactccaaactgcctgcaaactcaagactcaattcccacttattcgccccactgcgtgaaaacggctgaatagaaatttctcgg
taaggtctcatcgatattcagctttacaatggtgtgcctaactccaactttattaaactagcggag