Description :
From Genome Similarity Track
Location :
Scaffold_589:7714- 9835
Sequence
2121 bases(100 bases per row)
CCGACCGTGTCAGAGGAGTCTGGGCCCTGGACTTCGAGTCGCTTGAAGCGACGTCGGTCTGAACAAAGTTCAGACCCGACTTGCGGCGGCTAACGTGACG
TGACACTTCGTTACCCACGTCGTGATGTCGCGCTGACGACATCAGAGGCACTCAAGACCTCGTGTGGCACTGCGTTCCCACCCAGAAGGCATCTTCAATG
CCTTCGTTTTCAGTTATAGTCTGGGTTACTGCGTGTGGTACTGTGTTAGTCTCATAGGAAGCGCACCCAGCGTCTTTCTCTTTAGCTAAGGTCTGAGCGA
CCGTGTGGACCTAAATTACTCACCTGGTTAGCTCTAATAGGCATAACCACTGTCGAAGCCCGTACGGCGCGACGACGTTCGGCGTTGGACGCTGCTGGTC
CACACGCTGGACAAAAGACCCATGCCCGTGGCATTGCCGCAGCGGAGCATTGTCTTGTTGTACGCAGAGCTGTCGGCACGTTGACAGCTCTGTGACGTTT
CTGCGTCCTGGCGGTCTGTATTAGACGCCCAAGTCTTGACGGAGGTGGGATCATGACTCACCATGCTCCGCCACAGACCTGGCCTGGCAGGCCTATTCCT
GCCTTGTCACACCAAAGTCCGGACTGTGCTTTATGTTCGGCACAGCCATGATGTTCACGGCGAGACTGCGAGCGACACCGTGGTGCACGAATGCATCGAA
CACAAACGTTCATGTCCGTTTGAGGACCATTGGTACTTCCTTCACCATACCAAAAGCTAGTCCACCAAGGACCAGCCCACGACTGCCACTCTGACATAGC
GTACAGGCCGCTGTCGCTATGCCAAGCGATGTTCCGGCGGCGTATCAACGCCCCCAAACTCATAAAACGTTCAAGGGGTACTGTACTCCCGTACACCGAG
TGTACTACCAGCAGCCCATCACTGCCCTTTACCAGTTTGAGAGAGCCACTTCACGCTGGGCTAAGTCCCGTGGTATGCCGACCTGCACACCCGTTACGAA
GACTTACCGCTCTTCAGTAGGGCATACCGCCTCTACTGGTGGCGAGCGAGCCTTCGTTCACCTGGCCATGGTCTGCGCCACCGGACCTTGGGTCCACGGG
CGATCTTCTTCCCGAGGACTGGCAAGGAACAAACACGCAGAAGTGTCCATGTCCGCCGCACCCGTAGCAGCGGACCAAGCTCTCGGCTGAGCTTAAGTCC
ATGGGTTAGAGCTCGCTGTACGCCTTGCTATCAACAGGCTGCGTCACAGCAGGAGCAACAACGTCATTGCTGTGATTGCCCGCCTCCCGAGGAACGCCAT
CCTCATCGTGGCGATGTTCCGCTTCCCGAGAAGTACCAGCCTGCTTGTGCTGTACGCTTCTTGGAGGGCGATTGGAATCGCCTCCTCCATAGTTGTCGAT
TGCACCCGGAATAGCTGGGTGCGAGCAGGGCCGACCTTCAGGCCACCCATGAAGACTGTTGTCTTGATGTTTTCAGGCAGAGGATTCCCTGCCAGAAATG
CCAACGTGCGCATCTCTTGCACGTAGTCCTGCAGCTCGTGTTTACCTTGCTTAGATGCAAGAACGCGCTGTTCACCGGTAGGAACGCGGCTCGAAGCTGT
TCACACAGCTGAGCTTAGGATTTGAAGCATCCAGGAGATTTCGTCTCCCTGGTGTATGCCCAGTGTTTGGCACGCCCGCCAAGGTTGGACAAGGGCAAAC
GCTTCCAAGATGAGAGCCTTCATGGCGATCTCCACCTCACGGACCCAGAAGTGAAGGTTCTCTCCTTCCTTCCCCTCAAACACGGCGACCCCCAGCGTTA
CCGGCTTAGGCTAGGTTGCCTAGGGTGCGGCCATCGCGACCTCTAAGCTTCCGCGGACGTGAGCAATGAGACCACGTTCGTAAGTCTCAAATGCAGTCAC
GCGTTCGTGTTGCTCAGTAGGCGTCGCCGCCGCCAAGCTGCGAAGGACATCTTGTCCAAAGATACACCCTTCTTGCGAACAGACTCGTACTGTGAGTTGT
TCAAGCAAGGAAACGCACTTCGGTCCATTGTGGGTTAAACGTAGAGCACACAGAGGATTCAGGGTGGTCAATCTACCCACGAAGGCGTAGGATTGACTAC
GAGTGCTACCAAGTGTACCGG